Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 5 showing 81 ~ 100 out of 783 results
Snippet view Table view Download 783 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_40252

http://www.addgene.org/40252

Species: Synechococcus elongatus PCC 7942
Genetic Insert: Gm cassette (BssHII+SphI)
Vector Backbone Description: Vector Backbone:pAM1303; Vector Types:Cyanobacteria cloning vector; Bacterial Resistance:Gentamicin
References:
Comments: NS1 vector Gm resistant version of pAM1303. Both pAM1303 and pAM3511 were digested with BssHII and SphI, and then mix-ligated. The accC1gene (Gm) replaces the aadA gene (SpSm) in the Ω cassette. The upstream T4 terminator was lost due to SphI digestion.

Proper citation: RRID:Addgene_40252 Copy   


  • RRID:Addgene_25759

http://www.addgene.org/25759

Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: Entry vector with U6-driven G beta 2 miR-shRNA G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA

Proper citation: RRID:Addgene_25759 Copy   


  • RRID:Addgene_25755

    This resource has 10+ mentions.

http://www.addgene.org/25755

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4218; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT

Proper citation: RRID:Addgene_25755 Copy   


  • RRID:Addgene_25757

http://www.addgene.org/25757

Species: Mus musculus
Genetic Insert: G alpha 12 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: Entry vector with U6-driven G alpha 12 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT Addgene sequence shows that this plasmid is missing the EcoRI site.

Proper citation: RRID:Addgene_25757 Copy   


  • RRID:Addgene_25752

    This resource has 1+ mentions.

http://www.addgene.org/25752

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4422; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT

Proper citation: RRID:Addgene_25752 Copy   


  • RRID:Addgene_25751

    This resource has 1+ mentions.

http://www.addgene.org/25751

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4347; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple cloning sites d/s of TRE

Proper citation: RRID:Addgene_25751 Copy   


  • RRID:Addgene_25767

    This resource has 1+ mentions.

http://www.addgene.org/25767

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4655; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: Entry vector with TRE-driven GFP

Proper citation: RRID:Addgene_25767 Copy   


  • RRID:Addgene_25763

http://www.addgene.org/25763

Species: Mus musculus
Genetic Insert: G alpha 13 and 12 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4641; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: Entry vector with TRE-driven G alpha 12 and 13 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function.

Proper citation: RRID:Addgene_25763 Copy   


  • RRID:Addgene_25762

http://www.addgene.org/25762

Species: Mus musculus
Genetic Insert: G alpha 13 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: Entry vector with TRE-driven G alpha 13 miR-shRNA G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT Addgene sequence shows that this plasmid is missing the SpeI site.

Proper citation: RRID:Addgene_25762 Copy   


  • RRID:Addgene_25765

http://www.addgene.org/25765

Species:
Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: Entry vector with TRE-driven luciferase miR-shRNA and co-expressed GFP Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT

Proper citation: RRID:Addgene_25765 Copy   


  • RRID:Addgene_25764

http://www.addgene.org/25764

Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: Entry vector with TRE-driven G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA Addgene sequence shows that this plasmid is missing the SpeI site.

Proper citation: RRID:Addgene_25764 Copy   


  • RRID:Addgene_25760

http://www.addgene.org/25760

Species:
Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: Entry vector with TRE-driven luciferase miR-shRNA Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT

Proper citation: RRID:Addgene_25760 Copy   


  • RRID:Addgene_25749

http://www.addgene.org/25749

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5303; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter + GFP spacer; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE

Proper citation: RRID:Addgene_25749 Copy   


  • RRID:Addgene_25748

    This resource has 10+ mentions.

http://www.addgene.org/25748

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4608; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE

Proper citation: RRID:Addgene_25748 Copy   


  • RRID:Addgene_37814

http://www.addgene.org/37814

Species: bacteria
Genetic Insert: Promotorless gfp reporter gene
Vector Backbone Description: Vector Backbone:pVS1/p15a; Vector Types:; Bacterial Resistance:Gentamicin
References:
Comments: Please refer to the attached table for a complete list of restriction sites in the MCS. This plasmid has the XbaI site.

Proper citation: RRID:Addgene_37814 Copy   


  • RRID:Addgene_21604

http://www.addgene.org/21604

Species:
Genetic Insert: UAS-hsp70 luciferase
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3415; Vector Backbone:pBluescript SK(-); Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
References:
Comments:

Proper citation: RRID:Addgene_21604 Copy   


  • RRID:Addgene_54343

http://www.addgene.org/54343

Species: Synthetic
Genetic Insert: C-D dummy
Vector Backbone Description: Backbone Marker:Parniske lab; Vector Backbone:pUC57 (Gent); Vector Types:cloning vector; Bacterial Resistance:Gentamicin
References:
Comments: L1 dummy.

Proper citation: RRID:Addgene_54343 Copy   


  • RRID:Addgene_47547

http://www.addgene.org/47547

Species: Homo sapiens
Genetic Insert: MEK5-DD
Vector Backbone Description: Backbone Marker:Addgene #25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
References:
Comments:

Proper citation: RRID:Addgene_47547 Copy   


  • RRID:Addgene_44586

http://www.addgene.org/44586

Species: Synthetic
Genetic Insert: Citrine-NLS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3374; Vector Backbone:pDONR207; Vector Types:; Bacterial Resistance:Gentamicin
References:
Comments:

Proper citation: RRID:Addgene_44586 Copy   


  • RRID:Addgene_45475

http://www.addgene.org/45475

Species:
Genetic Insert: Gentamycin
Vector Backbone Description: Backbone Marker:Bagdasarian Lab; Vector Backbone:pMMB67EH; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
References:
Comments: This is a vector control for IPTG-indicible E. coli relA gene.

Proper citation: RRID:Addgene_45475 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X