Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E.coli
Genetic Insert: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Derived from BL21(AI), grow in LB in BSL1 laboratory conditions
Genotype: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1
Genotyping primers: CATGTGCATGAAAACCACTGC / CTGGTTGGACGAAGAAGTGC (273 base amplicon)
Proper citation: RRID:Addgene_191530 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype: W3110 ∆waaL ∆lpxM
Proper citation: RRID:Addgene_132780 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: The BW-Para E. coli strain is used to screen the functions of chimeric AraC/XylS transcription activators using beta-galactosidase assays (after growing transformed cells on MOPS media). Plasmids encoding these chimeras are found at https://www.addgene.org/browse/article/28216962/. The protocol for the reporter assay is detailed in the manuscript. The genotype for BW-Para is [F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ-, rph-1, Δ(rhaD-rhaB)568, hsdR514], ΔlacI785::kan, ΔaraC771::kan, ΔrhaSR::(PBADmut:lacZ)]. The PBADmut:lacZ reporter construct integrated into the rhaSR KO locus comprises a synthetic Para-I promoter with -10/-35 sites of GATACT/TTTACA respectively and an ara-I DNA binding site proximal to the -35 site. The integrated 3.5 kb cassette coding for the reporter construct can be amplified from the genome using the primers: (forward) 5' - GGTGAAAGTTGGAACCTCTTAC - 3' and (reverse) 5'- GCGAGGAAGCGGAATATATCCCC - 3'. Cells should be freshly transformed prior to each assay.
Proper citation: RRID:Addgene_172602 Copy
Species: n/a
Genetic Insert: E. coli K-12 MG1655
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Primers used for Colony PCR Verification:
Forward primer = CGTGAGCGGTAAAGTTGTTG
Reverse primer = CGGAGCTGCAAGGTGTTTATAG
Proper citation: RRID:Addgene_251806 Copy
Species: n/a
Genetic Insert: MG1655 attP21::PR-mCherry::frt proC::frt hisL::frt
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Primers for sequence verification of hisL knock-out:
Fwd - prEP229, gtgaggataagaggtggcga
Rev - prEP230, tcctttccccgctcattcat
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Proper citation: RRID:Addgene_229552 Copy
Species: n/a
Genetic Insert: MG1655 attP21::PR-sfGFP::frt metB:frt proBA::proB74proA
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Primers for sequence verification of proB mutation:
Fwd - prEP169, cgcggttatgtgaagaacgt
Rev - prEP170, gtgatgtcgcgttataccgg
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Proper citation: RRID:Addgene_229551 Copy
Species: n/a
Genetic Insert: MG1655 attP21::PR-sfGFP::frt metB:frt
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Primers for sequence verification of metB knock-out:
Fwd - prEP213, acgatcggtctggcttagtt
Rev - prEP214, tgaccgtaaacccgcatagt
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Proper citation: RRID:Addgene_229549 Copy
Species: n/a
Genetic Insert: MG1655 attP21::PR-sfGFP::frt hisD:frt
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Primers for sequence verification of hisD knock-out:
Fwd - prEP209, ccggttttacgcctgcatat
Rev - prEP210, ccgaacgcccaactattctg
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Proper citation: RRID:Addgene_229548 Copy
Species: n/a
Genetic Insert: MG1655 attP21::PR-sfGFP::frt trpC::frt proBA::proB74proA
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Primers for sequence verification of proB mutation
Fwd - prEP169, cgcggttatgtgaagaacgt
Rev - prEP170, gtgatgtcgcgttataccgg
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Proper citation: RRID:Addgene_229547 Copy
Species: n/a
Genetic Insert: MG1655 attP21::PR-sfGFP::frt hisD:frt proBA::proB74proA
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Primers for sequence verification of proB mutation:
Fwd - prEP169, cgcggttatgtgaagaacgt
Rev - prEP170, gtgatgtcgcgttataccgg
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Proper citation: RRID:Addgene_229550 Copy
Species: N/A
Genetic Insert:
Vector Backbone Description: Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-B0033-PirWT-L3S3P21*)
Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint.
Proper citation: RRID:Addgene_248173 Copy
Species: N/A
Genetic Insert:
Vector Backbone Description: Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-RiboJ-B0064-Pir116-L3S3P21*)
Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint.
Proper citation: RRID:Addgene_248175 Copy
Species:
Genetic Insert: MG1655 attP21::PR-mYFP::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
References:
Comments: Strain Validation: Fluorescence, PCR for fluorescent marker gene.
Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid.
Proper citation: RRID:Addgene_230031 Copy
Species:
Genetic Insert: MG1655 attP21::PR-mCherry::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
References:
Comments: Strain Validation: Fluorescence, PCR for fluorescent marker gene.
Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. TB205 is fliC+ and wrongly annotated as ∆fliC in PMID 28428424.
Proper citation: RRID:Addgene_230034 Copy
Species:
Genetic Insert: MG1655 attP21::PR-sfGFP::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
References:
Comments: Strain Validation: Fluorescence, PCR for fluorescent marker gene.
Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid.
Proper citation: RRID:Addgene_230033 Copy
Species:
Genetic Insert: MG1655 attP21::PR-mCerulean::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
References:
Comments: Strain Validation: Fluorescence, PCR for fluorescent marker gene.
Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid.
Proper citation: RRID:Addgene_230032 Copy
Species:
Genetic Insert: MG1655 attP21::PR-mCherry::frt trpC::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
References:
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
trpC_fwd: AACGTCGCCATGTTAATGCG
trpC_rev: GAACTGAGCCTGAAATTCAGG
Proper citation: RRID:Addgene_230038 Copy
Species:
Genetic Insert: MG1655 attP21::PR-sfGFP::frt trpC::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
References:
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
trpC_fwd: AACGTCGCCATGTTAATGCG
trpC_rev: GAACTGAGCCTGAAATTCAGG
Proper citation: RRID:Addgene_230037 Copy
Species:
Genetic Insert: None
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons, disruption of prfA, and frameshift in fabR and deletion of selABC.
Proper citation: RRID:Addgene_234550 Copy
Species:
Genetic Insert: ΔrpiAB Δedd strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_234837 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
