Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: ZNF791
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_153358.2 Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_144969 Copy
Species: Other
Genetic Insert: LbCas12a-Plus-P2A-mCherry
Vector Backbone Description: Vector Backbone:PbluSKP; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35468792
Proper citation: RRID:Addgene_191230 Copy
Species: Homo sapiens
Genetic Insert: TCF23
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_175769.2 Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_144966 Copy
Species: Homo sapiens
Genetic Insert: NR1I3
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_001077480.2 Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_144967 Copy
Species: Homo sapiens
Genetic Insert: RARA
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_001145301.2 Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_144975 Copy
Species: Homo sapiens
Genetic Insert: BATF3
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_018664.2 Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_144976 Copy
Species: Homo sapiens
Genetic Insert: ZNF280C
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_017666.4 Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_144973 Copy
Species: Homo sapiens
Genetic Insert: APEX1
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_001641.3 Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_144974 Copy
Species: Homo sapiens
Genetic Insert: SUMO1
Vector Backbone Description: Backbone Size:2850; Vector Backbone:Gateway Donor vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29269788
Proper citation: RRID:Addgene_114388 Copy
Genetic Insert: bpNLS-N terminal of nSpCas9-linker-mAAG (R165E/Y179F)-TadA-8e-linker-C terminal of nSpCas9-bpNLS-P2A-GFP
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37322276
Proper citation: RRID:Addgene_204607 Copy
Species: Guillardia theta
Genetic Insert: GtFz1
Vector Backbone Description: Vector Backbone:pRS426; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37380027
Proper citation: RRID:Addgene_205258 Copy
Species: Homo sapiens
Genetic Insert: CERS6
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_001256126.1 Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_144977 Copy
Species: Synthetic
Genetic Insert: miniSdd7-nSpCas9(D10A)-UGI-mScarlet
Vector Backbone Description: Backbone Marker:Qi-jun Chen; Vector Backbone:pBSE901; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37379837
Comments: Please visit https://doi.org/10.1101/2023.05.21.541555 for bioRxiv preprint.
Proper citation: RRID:Addgene_204855 Copy
Species: Synthetic
Genetic Insert: (NLS)SV40A5-EGFP-4PrA
Vector Backbone Description: Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35681009
Comments: Internal lab code: IG034/P287
Proper citation: RRID:Addgene_201344 Copy
Species: Synthetic
Genetic Insert: miniSdd7-nSpCas9(D10A)-UGI
Vector Backbone Description: Backbone Marker:Caixia Gao; Vector Backbone:pH-nCas9-PBE; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37379837
Comments: Please visit https://doi.org/10.1101/2023.05.21.541555 for bioRxiv preprint.
Proper citation: RRID:Addgene_204856 Copy
Species: Synthetic
Genetic Insert: None
Vector Backbone Description: Backbone Marker:Self-made; Vector Backbone:Unspecified; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36896468
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.10.15.511792v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_197836 Copy
Species: Synthetic
Genetic Insert: Ddd9-N
Vector Backbone Description: Backbone Marker:David Liu; Vector Backbone:pCMV_BE4max; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37379837
Comments: Please visit https://doi.org/10.1101/2023.05.21.541555 for bioRxiv preprint.
Proper citation: RRID:Addgene_204853 Copy
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pH2rU3; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36868218
Comments: For cloning lentiviral entry proteins into this plasmid digest it with MluI and AscI enzymes and use HiFi reaction to clone in the viral protein.
For making non-neutralizible standard you need to first barcode mCherry gene. To do so amplify mChery from the backbone using forward (CAGCCGAGCCACATCGCTC)
and reverse (CGGAAGAGCGTCGTGTAGGGAAAG) primers and gel purify the product. Use the product to barcode the mCherry gene using forward primer (gcacgcgCAGCCGAGCCACATCGCTCA) and one if reverse the primers containing unique barcodes. (gcggaactccactaggaacatttctctctcgaaTCTAGAtactttactactgcacAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAggaccattgcgacgtaAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAcctagccactagatggAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAatggagggagtctactAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAtagtgtaaacgccacgAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAccaacgcgtgaatcgcAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAatcgtatccatgggtaAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAggtcacgtgtctatatAGATCGGAAGAGCGTCGTGTAGGGAAAGAG). Gel and bead purify the products and perform HiFi reaction to insert the barcoded gene into pH2rU3_ForInd_mCherry_CMV_ZsGT2APurR vector that has been digested with MluI and XbaI enzymes. Transform the HiFi reaction into stable cells (e.g. NEB 10b cells). Screen colonies for correct barcodes and pool all 8 barcoded plasmids together before performing lentivirus rescues.
Proper citation: RRID:Addgene_204579 Copy
Species: Synthetic
Genetic Insert: miniSdd7-nSpCas9(D10A)-UGI
Vector Backbone Description: Backbone Marker:Caixia Gao; Vector Backbone:pnCas9-PBE; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37379837
Comments: Please visit https://doi.org/10.1101/2023.05.21.541555 for bioRxiv preprint.
Proper citation: RRID:Addgene_204859 Copy
Species: Synthetic
Genetic Insert: miniSdd6-nSpCas9(D10A)-UGI
Vector Backbone Description: Backbone Marker:Caixia Gao; Vector Backbone:pnCas9-PBE; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37379837
Comments: Please visit https://doi.org/10.1101/2023.05.21.541555 for bioRxiv preprint.
Proper citation: RRID:Addgene_204858 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
