Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: TDP-43_CTD_L330A
Vector Backbone Description: Backbone Size:4002; Vector Backbone:pJ411; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41298366
Comments: Please visit https://doi.org/10.1101/2024.07.05.602258 for bioRxiv preprint.
Proper citation: RRID:Addgene_248879 Copy
Genetic Insert: EGFP and CRY2-fused STIM1 fragment (a.a.238-448)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3946; Vector Backbone:pCMV; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37848907
Comments: CRY2(E281A) MKMDKKTIVWFRRDLRIEDNPALAAAAHEGSVFPVFIWCPEEEGQFYPGRASRWWMKQSLAHLSQSLKALGSDLTLIKTHNTISAILDCIRVTGATKVVFNHLYDPVSLVRDHTVKEKLVERGISVQSYNGDLLYEPWEIYCEKGKPFTSFNSYWKKCLDMSIESVMLPPPWRLMPITAAAEAIWACSIEELGLENEAEKPSNALLTRAWSPGWSNADKLLNEFIEKQLIDYAKNSKKVVGNSTSLLSPYLHFGEISVRHVFQCARMKQIIWARDKNSEGAESADLFLRGIGLREYSRYICFNFPFTHEQSLLSHLRFFPWDADVDKFKAWRQGRTGYPLVDAGMRELWATGWMHNRIRVIVSSFAVKFLLLPWKWGMKYFWDTLLDADLECDILGWQYISGSIPDGHELDRLDNPALQGAKYDPEGEYIRQWLPELARLPTEWIHHPWDAPLTVLKASGVELGTNYAKPIVDIDTARELLAKAISRTREAQIMIGAA
STIM1(238-448)
KEHMKKMMKDLEGLHRAEQSLHDLQERLHKAQEEHRTVEVEKVHLEKKLRDEINLAKQEAQRLKELREGTENERSRQKYAEEELEQVREALRKAEKELESHSSWYAPEALQKWLQLTHEVEVQYYNIKKQNAEKQLLVAKEGAEKIKKKRNTLFGTFHVAHSSSLDDVDHKILTAKQALSEVTAALRERLHRWQQIEILCGFQIVNNPGIH
Proper citation: RRID:Addgene_248295 Copy
Species: Homo sapiens
Genetic Insert: CIBN-fused STIM1 fragment (a.a.238-685)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3953; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37848907
Comments: CIBN
MNGAIGGDLLLNFPDMSVLERQRAHLKYLNPTFDSPLAGFFADSSMITGGEMDSYLSTAGLNLPMMYGETTVEGDSRLSISPETTLGTGNFKAAKFDTETKDCNEAAKKMTMNRDDLVEEGEEEKSKITEQNNGSTKSIKKMKHKAKKEENNFSNDSSKVTKELEKTDYI
STIM1(238-685)
KEHMKKMMKDLEGLHRAEQSLHDLQERLHKAQEEHRTVEVEKVHLEKKLRDEINLAKQEAQRLKELREGTENERSRQKYAEEELEQVREALRKAEKELESHSSWYAPEALQKWLQLTHEVEVQYYNIKKQNAEKQLLVAKEGAEKIKKKRNTLFGTFHVAHSSSLDDVDHKILTAKQALSEVTAALRERLHRWQQIEILCGFQIVNNPGIHSLVAALNIDPSWMGSTRPNPAHFIMTDDVDDMDEEIVSPLSMQSPSLQSSVRQRLTEPQHGLGSQRDLTHSDSESSLHMSDRQRVAPKPPQMSRAADEALNAMTSNGSHRLIEGVHPGSLVEKLPDSPALAKKALLALNHGLDKAHSLMELSPSAPPGGSPHLDSSRSHSPSSPDPDTPSPVGDSRALQASRNTRIPHLAGKKAVAEEDNGSIGEETDSSPGRKKFPLKIFKKPLKK
Proper citation: RRID:Addgene_248296 Copy
Genetic Insert: GFP nanobody (vhhGFP) fused to CRY2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3937; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37848907
Comments: vhhGFP
MVQLVESGGALVQPGGSLRLSCAASGFPVNRYSMRWYRQAPGKEREWVAGMSSAGDRSSYEDSVKGRFTISRDDARNTVYLQMNSLKPEDTAVYYCNVNVGFEYWGQGTQVTVSS
CRY2(E281A) MKMDKKTIVWFRRDLRIEDNPALAAAAHEGSVFPVFIWCPEEEGQFYPGRASRWWMKQSLAHLSQSLKALGSDLTLIKTHNTISAILDCIRVTGATKVVFNHLYDPVSLVRDHTVKEKLVERGISVQSYNGDLLYEPWEIYCEKGKPFTSFNSYWKKCLDMSIESVMLPPPWRLMPITAAAEAIWACSIEELGLENEAEKPSNALLTRAWSPGWSNADKLLNEFIEKQLIDYAKNSKKVVGNSTSLLSPYLHFGEISVRHVFQCARMKQIIWARDKNSEGAESADLFLRGIGLREYSRYICFNFPFTHEQSLLSHLRFFPWDADVDKFKAWRQGRTGYPLVDAGMRELWATGWMHNRIRVIVSSFAVKFLLLPWKWGMKYFWDTLLDADLECDILGWQYISGSIPDGHELDRLDNPALQGAKYDPEGEYIRQWLPELARLPTEWIHHPWDAPLTVLKASGVELGTNYAKPIVDIDTARELLAKAISRTREAQIMIGAA
Proper citation: RRID:Addgene_248298 Copy
Species: Homo sapiens
Genetic Insert: Myc-TRIP12-SB
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:2517; Vector Backbone:pENTR; Vector Types:Mammalian Expression, Cloning vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41480640
Proper citation: RRID:Addgene_216766 Copy
Species: Homo sapiens
Genetic Insert: Myc-TRIP12
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:2517; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41480640
Proper citation: RRID:Addgene_216762 Copy
Species: Homo sapiens
Genetic Insert: Flag-Polb
Vector Backbone Description: Backbone Size:2580; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41480640
Proper citation: RRID:Addgene_216774 Copy
Species: Synthetic
Genetic Insert: cat
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:40927394
Proper citation: RRID:Addgene_243836 Copy
Species: Synthetic
Genetic Insert: bla
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:40927394
Proper citation: RRID:Addgene_243839 Copy
Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Vector Backbone:pFN224C NanoLuc(R) CMV-Neo BiBRET-Balanced Vector and pFN222K HaloTag(R) CMV-Blast BiBRET Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_238826 Copy
Species: Homo sapiens
Genetic Insert: TEAD2
Vector Backbone Description: Vector Backbone:pFC221K HaloTag(R) CMV-Blast BiBRET Vector and pFN224C NanoLuc(R) CMV-Neo BiBRET-Balanced Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_238669 Copy
Species: Synthetic
Genetic Insert: aph
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:40927394
Proper citation: RRID:Addgene_243840 Copy
Species: Synthetic
Genetic Insert: Stuffer2
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:40927394
Proper citation: RRID:Addgene_243847 Copy
Species: Homo sapiens
Genetic Insert: P2A-tdTomato flanked by MAFA homology regions
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41483810
Proper citation: RRID:Addgene_246654 Copy
Species: Gordonibacter urolithinfaciens DSM 27213
Genetic Insert: Eah
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41439715
Proper citation: RRID:Addgene_249564 Copy
Species: Gordonibacter urolithinfaciens DSM 27213
Genetic Insert: Eadh1
Vector Backbone Description: Vector Backbone:pXD80; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41439715
Proper citation: RRID:Addgene_249567 Copy
Species: Gordonibacter urolithinfaciens DSM 27213
Genetic Insert: Eadh3
Vector Backbone Description: Vector Backbone:pXD80; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41439715
Proper citation: RRID:Addgene_249569 Copy
Species: Synthetic
Genetic Insert: PixE
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3968; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:40624072
Comments: Additional sequencing primer may be needed: gcattaatgctacagcccat
Proper citation: RRID:Addgene_250232 Copy
Species: Synechocystis sp. PCC6803
Genetic Insert: PixD
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3973; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:40624072
Proper citation: RRID:Addgene_250231 Copy
Species: G. hirsutum (cotton)
Genetic Insert: GhSFT
Vector Backbone Description: Backbone Marker:Tuttle et al Plant Methods. 2012 Aug 1;8(1):27. doi: 10.1186/1746-4811-8-27.; Vector Backbone:pJRT.Agro.CLCrVA.008; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:40394900
Proper citation: RRID:Addgene_234901 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
