Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: PalmReNL
Vector Backbone Description: Backbone Marker:Michael H. Bachmann; Vector Backbone:pKT2/CAGXSP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36619349
Proper citation: RRID:Addgene_182970 Copy
Species: Homo sapiens
Genetic Insert: CD63-mScarlet
Vector Backbone Description: Backbone Marker:Michael H. Bachmann; Vector Backbone:pKT2/CAGXSP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36619349
Proper citation: RRID:Addgene_182972 Copy
Species: Other
Genetic Insert: PalmGamillus
Vector Backbone Description: Backbone Marker:Michael H. Bachmann; Vector Backbone:pKT2/CAGXSP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36619349
Proper citation: RRID:Addgene_182971 Copy
Genetic Insert: EYFP
Vector Backbone Description: Vector Backbone:pRSF1010; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32379958
Proper citation: RRID:Addgene_182928 Copy
Species: Synthetic
Genetic Insert: ddcpf1
Vector Backbone Description: Vector Backbone:pRSF1010; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32379958
Proper citation: RRID:Addgene_182927 Copy
Genetic Insert: SARS-CoV-2-RBD(aa324-526)-B.1.1.529
Vector Backbone Description: Vector Backbone:pVRC8400; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35609088
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.12.29.474491v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_182930 Copy
Species: Maribacter polysiphoniae DSM 23514
Genetic Insert: MapSPARTA operon (6xHis-MBP-MapTIR-APAZ and MapAgo)
Vector Backbone Description: Backbone Marker:Scott Gradia; Backbone Size:6465; Vector Backbone:pET-His6-MBP-TEV-LIC cloning vector (1M); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35381200
Proper citation: RRID:Addgene_183145 Copy
Species: Arabidopsis thaliana
Genetic Insert: PYR1
Vector Backbone Description: Backbone Size:1774; Vector Backbone:pYTK084; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35726092
Proper citation: RRID:Addgene_183176 Copy
Species: Synthetic
Genetic Insert: AAV9 modified with 7mer insertion between amino acids 588 and 589 of VP1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pUC57-Kan; Vector Types:AAV; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35571675
Proper citation: RRID:Addgene_183749 Copy
Genetic Insert: H-ferritin iron response element
Vector Backbone Description: Backbone Marker:Available at Addgene (#18673); Backbone Size:6270; Vector Backbone:pYIC; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17023487
Comments: An oligonucleotide with one copy of H-ferritin iron response element, IRE, was inserted into the 5'UTR of pYIC DNA to generate a bicistronic reporter gene with IRE: The IRE was inserted at the NheI and SacI sites (pIRE-YIC; 15 nt downstream of transcription start site and 9 nt upstream of YFP translational start site).
Proper citation: RRID:Addgene_18784 Copy
Genetic Insert: TRAP binding site
Vector Backbone Description: Backbone Marker:Available at Addgene (#18673); Backbone Size:6270; Vector Backbone:pYIC; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17023487
Comments: An oligonucleotide with a 55-nt TRAP-binding sequence, TBS, was inserted into the 5'UTR of pYIC DNA to generate a bicistronic reporter gene with TBS: The TBS was inserted in the SacI site for 5-UTR (pTBS/5Y-YIC; 45 nt downstream of transcription start site and 9 nt upstream of YFP translational start site).
Proper citation: RRID:Addgene_18786 Copy
Species: Homo sapiens
Genetic Insert: Bicistronic fluorescent reporter gene with cap-dependent EYFP and IRES-dependent ECFP translation under the control of CMV promo
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5300; Vector Backbone:pIRES2-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17023487
Comments: EYFP tagged at N-terminus with 3 copies of Myc epitope tags and at C-terminus with a copy of FLAG and polyhistidine (His6) epitope tags. ECFP tagged at the C-terminus with one copy of hemagglutinin (HA) and polyhistidine (His6) epitope tags.
EGFP of pIRES2-EGFP (Clontech) replaced at an 803 bp BstXI-NotI, PCR amplified fragment with ECFP from pECFP-Mito (Clontech) tagged at the C-terminus with a single copy of hemagglutinin (HA) and polyhistidine (His6) epitope tags; IRES-dependent translation yields ECFP-HA-His6 fusion protein. 895 bp Sac I/Eco RI fragment containing amino terminal 3 Myc epitope tags fused to EYFP obtained from PCR amplification of pEYFP-N1 (Clontech), which is also tagged at C-terminus with a single copy of FLAG and polyhistidine (His6) epitope tag; cap-dependent translation yields 3Myc-EYFP-Flag-His6 fusion protein.
See article for detailed information.
Proper citation: RRID:Addgene_18673 Copy
Species: Mus musculus
Genetic Insert: thioredoxin-interacting protein
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16301999
Proper citation: RRID:Addgene_18758 Copy
Genetic Insert: Kusabira ; M-mCherry ; M-mEYFP ; M-mCerulean
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:0; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17972876
Comments: The Author's Map is a representative Brainbow 1.1 construct (M= membrane tethered).
Please see attached PDF for important additional information.
Proper citation: RRID:Addgene_18722 Copy
Genetic Insert: hrGFPII-NLS ; EYFP ; tdimer2 ; M-mCerulean
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:0; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17972876
Comments: The Author's Map is a representative Brainbow 2.1 construct (M= membrane tethered).
Please see attached PDF for important additional information.
Proper citation: RRID:Addgene_18723 Copy
Species: Mus musculus
Genetic Insert: Sidekick-2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-N1 (EGFP deleted); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18216854
Comments: The NdeI-NotI fragment obtained from mKIAA1514 plasmid was cloned into the XhoI and NotI sites of EGFP-N1, and the XhoI-NdeI fragment was replaced by a cDNA amplified with primers GGCCCTCGAGTTATAAAGCAACTCGCAAAGAGG and CTGTTGTAGGCAGCCACCTCGATC.
Proper citation: RRID:Addgene_18735 Copy
Species: Mus musculus
Genetic Insert: Dscam
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-N1 (EGFP deleted); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18216854
Comments: An AccI-NotI fragment from IMAGE clone 6410759 (ATCC) was cloned into the SalI/NotI sites of EGFP-N1. The AccI-AccI fragment was then replaced with cDNA amplified from mouse brain using primers GGCCGTCGACGTGGCTCGCTCGCTGGCTCGCTGGCT and CGACTCCAGCCGAGTTGTTGGCAGT.
Proper citation: RRID:Addgene_18737 Copy
Species: Mus musculus
Genetic Insert: Type II transmembrane serine protease 6
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1 (Clontech); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18451267
Proper citation: RRID:Addgene_18792 Copy
Species: Mus musculus
Genetic Insert: Type II transmembrane serine protease 6
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-N1 (Clontech); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18451267
Proper citation: RRID:Addgene_18793 Copy
Species: Homo sapiens
Genetic Insert: STIM1
Vector Backbone Description: Backbone Size:0; Vector Backbone:Gateway; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17517596
Proper citation: RRID:Addgene_18860 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
