Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: human Dynamin 1aa
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11782545
Proper citation: RRID:Addgene_22163 Copy
Genetic Insert: Tetracycline repressor
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2386; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Yeast Expression, Worm Expression, Insect Expression; Bacterial Resistance:Kanamycin
Comments: Please note that there are several sequence discrepancies between Addgene's quality control sequence and the depositor's reference sequence. These changes do not affect plasmid function.
Proper citation: RRID:Addgene_22265 Copy
Genetic Insert: SV40 Large T antigen TK1 mutant (E107K)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2279; Vector Backbone:pENTR1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: Large T antigen K1 mutant can no longer bind and inactivate the Rb, p130 and p107 proteins (DeCaprio et al. 1988, Stubdal et al. 1997). It also fails to activate Akt (Yu and Alwine 2008).
Proper citation: RRID:Addgene_22270 Copy
Species: Homo sapiens
Genetic Insert: INSR insulin receptor
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17563366
Proper citation: RRID:Addgene_22286 Copy
Species: Homo sapiens
Genetic Insert: Synaptojanin 1_145
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17158794
Proper citation: RRID:Addgene_22293 Copy
Species: Mus musculus
Genetic Insert: Seryl tRNA synthetase (SRS) – mouse cytoplasmic dynein microtubule binding domain (MTBD) fusion protein
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:0; Vector Backbone:pET42a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_22388 Copy
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pDONRP2r-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17948311
Comments: This clone was amplified with an attB2 site, at the 5’ end and a attB3 site on the 3’ end. The product was then recombined with the pDNR P2R-P3 vector.
Can be used to make 3’ end (C-Term) tagged fusion construct.
Proper citation: RRID:Addgene_22462 Copy
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pDONR; Vector Types:Entry clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17948311
Comments: Egfp ORF was amplified with an attB1 site on the 5’ end and an attB2 site on the 3’ end. ORF is in frame with 3’ entry clone.
Egfp ORF missing the termination codon.
Proper citation: RRID:Addgene_22464 Copy
Species: Caenorhabditis elegans
Genetic Insert: Pmex-5::mCherry (w introns w/o stop)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2646; Vector Backbone:pDONRP4P1R; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21637852
Proper citation: RRID:Addgene_22513 Copy
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17948311
Proper citation: RRID:Addgene_22453 Copy
Species: Mus musculus
Genetic Insert: Seryl tRNA synthetase (SRS) – mouse cytoplasmic dynein microtubule binding domain (MTBD) fusion protein
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:0; Vector Backbone:pET42a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_22392 Copy
Genetic Insert: sh Ataxia telangiectasia mutated
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2571; Vector Backbone:pENTR1A; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: shATM #2 was used successfully in Rodier et al.(2009) Nat.Cell Biol. 11(8):973-979.
Proper citation: RRID:Addgene_22527 Copy
Species: A. victoria
Genetic Insert: CyPet
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCyPet-C1-Control; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19693013
Proper citation: RRID:Addgene_22779 Copy
Genetic Insert: fret-STOP-fret
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11751630
Comments: Plasmid containing FRT-STOP-FRT cassette for use in expressing genes only after Flp-mediated recombination.
It's like the LSL cassette ( http://www.addgene.org/11584 but this one is a FSF cassette
Proper citation: RRID:Addgene_22774 Copy
Species: Mus musculus
Genetic Insert: Myelin Transcription Factor 1
Vector Backbone Description: Backbone Marker:R. Armstrong; Backbone Size:5635; Vector Backbone:pIRESRed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:14962745
Comments: Mu Myt1 complete sequence includes 7 Zn Fingers and a Myc Tag. This was subcloned into pIRES/Red made by R. A. Armstrong. The DsRed does not express due to problem with IRES
This Myt1-7zf DNA was cut from the full-length clone (pMycMyt1-7zf) which was a gift of Dr. Jacob Hecksher-Sorensen.
Proper citation: RRID:Addgene_22652 Copy
Species: Homo sapiens
Genetic Insert: Rev Erb alpha
Vector Backbone Description: Backbone Marker:Available at Addgene (#16405); Backbone Size:9000; Vector Backbone:pAdTrack-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20018698
Proper citation: RRID:Addgene_22745 Copy
Species: Mus musculus
Genetic Insert: shALAS-1
Vector Backbone Description: Backbone Marker:Available at Addgene (#16404); Backbone Size:8300; Vector Backbone:pAdTrack; Vector Types:Mammalian Expression, Adenoviral, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20018698
Comments: targeting sequence: CCAAGATAGTAGCATTTGAAA
Proper citation: RRID:Addgene_22748 Copy
Genetic Insert: modified pCMV-DsRed-Express (Clontech)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4600; Vector Backbone:pCMV-DsRed-Express; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18987208
Comments: modified pCMV-DsRed-Express (Clontech)) Have inserted 2 sites (NheI and BamHI upstream of DsRed-Express cassette and 2 sites downstream (BglII and NheI) = NheI-BamHI-DsRed-Express-BglII-EcoRI
Proper citation: RRID:Addgene_22743 Copy
Species: Mus musculus
Genetic Insert: Myelin Transcription Factor 1
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pCR-Blunt II TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin
Comments: 580bp Myt1 insert can be released with EcoRI. This is the 580bp cDNA probe for Northern blots. Paper is in preparation. Tentatively titled "The Myelin Transcription Factor 1 (Myt1) is Essential for Neural Development"
Proper citation: RRID:Addgene_22740 Copy
Species: Homo sapiens
Genetic Insert: PAK binding domain
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pYpet-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19693013
Proper citation: RRID:Addgene_22781 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.