Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: cavin-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5069; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20070607
Proper citation: RRID:Addgene_27709 Copy
Species: Canis lupus familiaris
Genetic Insert: caveolin-1, mutant D67G
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3961; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20070607
Comments: The point mutation D67G in the DXE motif delays export from the ER.
Proper citation: RRID:Addgene_27706 Copy
Species: Canis lupus familiaris
Genetic Insert: caveolin-1
Vector Backbone Description: Backbone Size:3961; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20070607
Proper citation: RRID:Addgene_27704 Copy
Species: Canis lupus familiaris
Genetic Insert: caveolin-1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3961; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20070607
Proper citation: RRID:Addgene_27703 Copy
Species: Rattus norvegicus
Genetic Insert: Abnormal spindle-like microcephaly associated
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17534152
Comments: Please note that though this plasmid is in the pCMV-myc backbone, the myc tag is NOT in frame with the insert.
Proper citation: RRID:Addgene_27668 Copy
Vector Backbone Description: Backbone Size:2783; Vector Backbone:pUC18; Vector Types:RNA Transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12888534
Proper citation: RRID:Addgene_27663 Copy
Vector Backbone Description: Backbone Size:2776; Vector Backbone:pUC18; Vector Types:RNA Transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12888534
Proper citation: RRID:Addgene_27664 Copy
Species: Homo sapiens
Genetic Insert: human ULK2 shRNA 91
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Comments: human ULK2 shRNA 91 TRC candidate.
shRNA oligo sequence - 5'-CCGGGTCAGTGGTATTCGCATCAAACTCGAGTTTGATGCGAATACCACTGACTTTTT - 3'
Proper citation: RRID:Addgene_27634 Copy
Species: Homo sapiens
Genetic Insert: human ULK1 shRNA 8
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Comments: human ULK1 shRNA 8 TRC candidate.
shRNA oligo sequence - 5'-CCGGACATCGAGAACGTCACCAAGTCTCGAGACTTGGTGACGTTCTCGATGTTTTTT - 3'
Proper citation: RRID:Addgene_27633 Copy
Species: Zea mays
Genetic Insert: MYB-RELATED transcription factor from EB705747
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25053252
Comments: This CDS was amplified using PCR from a full length cDNA template from the Maize Full-length cDNA Project (www.maizecdna.org), and the PCR product included the stop codon. The PCR product was cloned into a Gateway pENTR/D vector.
Further information on this gene may be obtained at www.grassius.org using the GenBank number. (The second half of the plasmid name is the GenBank Number for the sequence of the insert)
Proper citation: RRID:Addgene_27752 Copy
Species: Zea mays
Genetic Insert: ZmMYB39 transcription factor from AM156907
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25053252
Comments: This CDS was amplified using PCR from a full length cDNA template from the Maize Full-length cDNA Project (www.maizecdna.org), and the PCR product included the stop codon. The PCR product was cloned into a Gateway pENTR/D vector.
Further information on this gene may be obtained at www.grassius.org using the GenBank number. (The second half of the plasmid name is the GenBank Number for the sequence of the insert)
Proper citation: RRID:Addgene_27739 Copy
Species: Zea mays
Genetic Insert: ZmMYB8 transcription factor from AM156905
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25053252
Comments: This CDS was amplified using PCR from a full length cDNA template from the Maize Full-length cDNA Project (www.maizecdna.org), and the PCR product included the stop codon. The PCR product was cloned into a Gateway pENTR/D vector.
Further information on this gene may be obtained at www.grassius.org using the GenBank number. (The second half of the plasmid name is the GenBank Number for the sequence of the insert)
Proper citation: RRID:Addgene_27738 Copy
Species: Mus musculus
Genetic Insert: Abp1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5400; Vector Backbone:pEGFP-N1 (EGFP replaced with tDimer-RFP); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 4986658 (MGC:51371).
Cloned using Gateway acceptance vectors.
Proper citation: RRID:Addgene_27699 Copy
Species: Zea mays
Genetic Insert: C3H transcription factor from EC905431
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25053252
Comments: This CDS was amplified using PCR from a full length cDNA template from the Maize Full-length cDNA Project (www.maizecdna.org), and the PCR product included the stop codon. The PCR product was cloned into a Gateway pENTR/D vector.
Further information on this gene may be obtained at www.grassius.org using the GenBank number. (The second half of the plasmid name is the GenBank Number for the sequence of the insert)
Proper citation: RRID:Addgene_27732 Copy
Species: Homo sapiens
Genetic Insert: Eps15
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Proper citation: RRID:Addgene_27696 Copy
Species: Mus musculus
Genetic Insert: GAK
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 5705695 (MGC:86144).
Proper citation: RRID:Addgene_27695 Copy
Species: Mus musculus
Genetic Insert: Amphiphysin 1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 5686478 (MGC:64773).
Proper citation: RRID:Addgene_27692 Copy
Species: Mus musculus
Genetic Insert: BIN1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21445324
Comments: Cloned from IMAGE clone: 5718309 (MGC:90098).
Proper citation: RRID:Addgene_27693 Copy
Species: Mus musculus
Genetic Insert: mouse myc ULK1
Vector Backbone Description: Backbone Size:7341; Vector Backbone:pcDNA 6.2
V5
dest
(Invitrogen); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Comments: C-term V5 not expressed because of stop codon at end of ULK1.
Proper citation: RRID:Addgene_27629 Copy
Species: Mus musculus
Genetic Insert: mouse myc ULK1 K46I
Vector Backbone Description: Backbone Marker:Addgene plasmid 17399; Backbone Size:9135; Vector Backbone:pQCXIN Neo dest; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Proper citation: RRID:Addgene_27627 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
