Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Arabidopsis thaliana
Genetic Insert: SPL11 mutant
Vector Backbone Description: Backbone Size:0; Vector Backbone:pBIB-KAN-GW; Vector Types:used to create transgenic lines; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21123653
Comments: Created by cloning 5.5-kb (including 2.7 kb upstream of
CDS, CDS, and 1.3 kb downstream from CDS) genomic fragment in pENTR/D-TOPO (Invitrogen). The Quick-
Change Lightning Site-Directed Mutagenesis kit (Stratagene) was used on the resulting plasmids to disrupt miR156-binding sites (primers 5'-AATCTCAAGATATCCACCGTGCACTGTCATTGCTCTCAACCTCTTCGGATCCCCTGG-3' and 5'-CCAGGGGATCCGAAGAGGTTGAGAGCAATGACAGTGCACGGTGGATATCTTGAGATT-3').
This plasmid was recombined with pBIB-KAN-GW using LR clonase (Invitrogen).
Proper citation: RRID:Addgene_27387 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20868367
Proper citation: RRID:Addgene_27420 Copy
Species: Homo sapiens
Genetic Insert: post- ligation product of ligase ribozyme
Vector Backbone Description: Backbone Size:0; Vector Backbone:pUC19 modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19965478
Comments: pH307HP is used to transcribe RNA representing the post-
ligation product of the ribozyme. To ensure a homogenous 5´ terminus with the 5´- hydroxyl resembling that of the synthetic substrate, the transcript began with a hammerhead (HH) self-cleaving ribozyme, which excises itself from the ribozyme. The relevant sequence of the insert is
GCGTAATACGACTCACTATAGGGAGATTCCTACTGGACTGATGAGTCCGTGAGGACGAA
ACGGTACCCGGTACCGTCTCCAGTAGGAACACTATACTACTGGATAATCAAAGACAAAT
CTGCCCGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCT
CCGGTGGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCC
TCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGG
GACCCAC
See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was
digested with EarI nuclease.
Proper citation: RRID:Addgene_27385 Copy
Species: Homo sapiens
Genetic Insert: Gja1
Vector Backbone Description: Backbone Size:9387; Vector Backbone:plenti6.3/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20038810
Proper citation: RRID:Addgene_27383 Copy
Genetic Insert: U6 promoter, SFFV promoter, EmeraldGFP
Vector Backbone Description: Backbone Size:6747; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for shRNAs. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27359 Copy
Genetic Insert: U6 promoter, SFFV promoter, eYFP
Vector Backbone Description: Backbone Size:6747; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for shRNAs. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27357 Copy
Genetic Insert: U6 promoter, SFFV promoter, dsRed2
Vector Backbone Description: Backbone Size:6747; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for shRNAs. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27355 Copy
Genetic Insert: U6 promoter, SFFV promoter, dsRedExpress
Vector Backbone Description: Backbone Size:6747; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for shRNAs. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27356 Copy
Genetic Insert: U6 promoter, SFFV promoter, eGFP/BSD-Fusion
Vector Backbone Description: Backbone Size:6758; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for shRNAs. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). The marker is a fusion of eGFP and Blasticidin resistance (BSD). Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27354 Copy
Genetic Insert: U6 promoter, SFFV promoter, Cerulean
Vector Backbone Description: Backbone Size:6747; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for shRNAs. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27351 Copy
Genetic Insert: U6 promoter, SFFV promoter, dTomato
Vector Backbone Description: Backbone Size:6747; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for shRNAs. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27352 Copy
Genetic Insert: U6 promoter, SFFV promoter, Venus
Vector Backbone Description: Backbone Size:6747; Vector Backbone:LeGO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18362927
Comments: HIV-1 derived third generation lentiviral vector for shRNAs. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
Proper citation: RRID:Addgene_27350 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17974916
Proper citation: RRID:Addgene_27370 Copy
Species: Arabidopsis thaliana
Genetic Insert: SPL10 inverted
Vector Backbone Description: Backbone Size:0; Vector Backbone:UBI3pTpFSPGW-HYGv02; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21123653
Comments: SPL10-RNAi constructs were generated by amplifying 0.6kb
of the SPL10 CDS from cDNA prepared from inflorescence tissue total RNA isolated using TRIzol reagent (Invitrogen) and reverse-transcribed with oligo(dT) primers using SuperScript
III Reverse Transcriptase (Invitrogen). The resulting amplicons were then cloned into pCR8/GW-TOPO (Invitrogen) and then recombined with UBI3p::pFSPGW-HYGv02 to create an inverted repeat of the SPL10 cDNA fragment under the control
of the UBI3 promoter. For details regarding the UBI3p::pFSPGW-HYGv02 vector, please see the article.
Proper citation: RRID:Addgene_27409 Copy
Species: Arabidopsis thaliana
Genetic Insert: SPL10
Vector Backbone Description: Backbone Size:0; Vector Backbone:pBIB-KAN-GW; Vector Types:used to create transgenic lines; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21123653
Comments: Created by cloning 4.9-kb (including 1.8 kb upstream of CDS, CDS, and 1.6 kb downstream from CDS) genomic fragment in pENTR/D-TOPO (Invitrogen). This plasmid was recombined with pBIB-KAN-GW using LR clonase (Invitrogen).
Proper citation: RRID:Addgene_27407 Copy
Species: Arabidopsis thaliana
Genetic Insert: SPL10 mutant
Vector Backbone Description: Backbone Size:0; Vector Backbone:pBIB-KAN-GW; Vector Types:used to create transgenic lines; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21123653
Comments: Created by cloning 4.9-kb (including 1.8 kb upstream of CDS, CDS, and 1.6 kb downstream from CDS) genomic fragment in pENTR/D-TOPO (Invitrogen). The Quick-
Change Lightning Site-Directed Mutagenesis kit (Stratagene) was used on the resulting plasmids to disrupt miR156-binding sites (primers 5'-CCATGAATCTCATGATTTCTACAGTGCACTGTCATTGCTCTCAACTACTTCGGATTCACAAGGGATC-3' and 5'-GATCCCTTGTGAATCCGAAGTAGTTGAGAGCAATGACAGTGCACTGTAGAAATCATGAGATTCATGG-3').
This plasmid was recombined with pBIB-KAN-GW using LR clonase (Invitrogen).
Proper citation: RRID:Addgene_27408 Copy
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCGTAG; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21123653
Comments: The control sensor construct was created by cloning the potato UBI3 promoter into pENTR/D-TOPO (Invitrogen). The resulting plasmid was then recombined with pCGTAG. The promoter results in a ubiquitously expressed nuclear localized GFP.
Proper citation: RRID:Addgene_27405 Copy
Species: Homo sapiens
Genetic Insert: shYAP1
Vector Backbone Description: Backbone Size:8500; Vector Backbone:pLKO1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18579750
Comments: YAP shRNA sequence is - 5'-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC
Proper citation: RRID:Addgene_27368 Copy
Species: Aquifex aeolicus
Genetic Insert: leuT
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5700; Vector Backbone:pET16b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20463731
Comments: Codon-optimized (see pQO18-TEV; plasmid # ) leuT of Aquifex aeolicus (position 107 – 1699); including a 8-His tag and thrombin cleavage site coding region at the 3’ end of the gene)
Proper citation: RRID:Addgene_27401 Copy
Genetic Insert: tetR(sB)
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:2695; Vector Backbone:pDO41A; Vector Types:Bacterial Expression, Gateway Cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21203517
Comments: Addgene's sequencing results found a single nucleotide mismatch at bp# 2561 when compared to the full sequence information provided by the depositing laboratory.
Proper citation: RRID:Addgene_27365 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
