Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: αTubulin K40 acetyltransferase
Vector Backbone Description: Backbone Size:4981; Vector Backbone:pGEX-6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21068373
Proper citation: RRID:Addgene_27101 Copy
Species: Danio rerio
Genetic Insert: Zinc finger array targeting PTRF/Cavin1
Vector Backbone Description: Backbone Size:5493; Vector Backbone:MG414; Vector Types:Zebrafish Targeting; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18657511
Comments: This plasmid encodes a zinc finger array targeting half of a target sequence in the zebrafish gene PTRF/Cavin1 (see below). Please note that this plasmid does NOT contain the PTRF/Cavin1 sequence.
Users must order the complementary plasmid PTRF/Cavin1_L (OZ513) [Addgene plasmid 27188] in order to create a zinc finger nuclease (ZFN) pair to introduce targeted mutations into this specific zebrafish gene.
Users will also need to clone the zinc finger (ZF) insert of this plasmid into a zinc finger nuclease (ZFN) vector to express a FOKI fusion product. Examples of possible ZFN expression vectors that can be used are: pST1374 (Addgene plasmid 13426), pMLM290 (Addgene plasmid 21872), pMLM292 (Addgene plasmid 21873), pMLM800 (Addgene plasmid 27202) and pMLM802 (Addgene plasmid 27203).
This zinc finger array was tested for binding activity to the sequence 5'-GGAGGTGCC-3' in a bacterial two hybrid assay, and resulted in 6.81 fold activation. However, this array has not yet been tested for activity as a zinc finger nuclease (i.e. for its ability to induce mutations at the intended locus).
Scientists using this zinc finger array in a publication should notify [email protected] and acknowledge NIH grant number R01 GM088040 in the publication.
Other Articles:
"Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays." Maeder ML et al. (Nat Protoc. 2009 Sept 17. 4(10):1471-1501. Pubmed ID: 19798082
"Targeted mutagenesis in zebrafish using customized zinc-finger nucleases." Foley JE et al. (Nat Protoc. 2009 Dec 3. 4(12):1855-1867. Pubmed ID: 20010934
Proper citation: RRID:Addgene_27189 Copy
Species: Danio rerio
Genetic Insert: Zinc finger array targeting zgc:153086
Vector Backbone Description: Backbone Size:5493; Vector Backbone:MG414; Vector Types:Zebrafish Targeting; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18657511
Comments: This plasmid encodes a zinc finger array targeting half of a target sequence in the zebrafish gene zgc:153086 (see below). Please note that this plasmid does NOT contain the zgc:153086 sequence.
Users must order the complementary plasmid zgc:153086_L (OZ511) [Addgene plasmid 27186] in order to create a zinc finger nuclease (ZFN) pair to introduce targeted mutations into this specific zebrafish gene.
Users will also need to clone the zinc finger (ZF) insert of this plasmid into a zinc finger nuclease (ZFN) vector to express a FOKI fusion product. Examples of possible ZFN expression vectors that can be used are: pST1374 (Addgene plasmid 13426), pMLM290 (Addgene plasmid 21872), pMLM292 (Addgene plasmid 21873), pMLM800 (Addgene plasmid 27202) and pMLM802 (Addgene plasmid 27203).
This zinc finger array was tested for binding activity to the sequence 5'-GGAGGTGAG-3' in a bacterial two hybrid assay, and resulted in 10.23 fold activation. However, this array has not yet been tested for activity as a zinc finger nuclease (i.e. for its ability to induce mutations at the intended locus).
Scientists using this zinc finger array in a publication should notify [email protected] and acknowledge NIH grant number R01 GM088040 in the publication.
Other Articles:
"Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays." Maeder ML et al. (Nat Protoc. 2009 Sept 17. 4(10):1471-1501. Pubmed ID: 19798082
"Targeted mutagenesis in zebrafish using customized zinc-finger nucleases." Foley JE et al. (Nat Protoc. 2009 Dec 3. 4(12):1855-1867. Pubmed ID: 20010934
Proper citation: RRID:Addgene_27187 Copy
Species: synthetic gene
Genetic Insert: P#38-luxA-FLAG-luxB-DAS+4
Vector Backbone Description: Backbone Size:7843; Vector Backbone:pDE43-MEH; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:21075796
Proper citation: RRID:Addgene_27064 Copy
Species: Mus musculus
Genetic Insert: shRNA MKL1+2
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20466732
Comments: shRNA sequence for knockdown of both MKL1 and MKL2: CATGGAGCTGGTGGAGAAGAA
Proper citation: RRID:Addgene_27161 Copy
Vector Backbone Description: Backbone Marker:Glickman Lab; Backbone Size:4152; Vector Backbone:pmsg360; Vector Types:mycobacterial ko vector; Bacterial Resistance:Hygromycin
Defining Citation: PMID:20472794
Comments: Note that Addgene's sequencing results differ from the depositor's sequence at bp# 561, 565 and 829. Depositing scientist states that these differences do not affect the function of the plasmid.
Proper citation: RRID:Addgene_27155 Copy
Species: Homo sapiens
Genetic Insert: ELK1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20466732
Proper citation: RRID:Addgene_27156 Copy
Species: Lactococcus lactis and synthetic construct
Genetic Insert: surface (S)-layer protein promoter region fused with modified green fluorescent protein 5
Vector Backbone Description: Backbone Size:2959; Vector Backbone:pBluescript II KS(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20455948
Proper citation: RRID:Addgene_27171 Copy
Species: Homo sapiens
Genetic Insert: BiP
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12110171
Proper citation: RRID:Addgene_27166 Copy
Genetic Insert: SV40 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4045; Vector Backbone:pRL-TK; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10373518
Comments: pRL-SV40P was generated by placing the simian virus 40 (SV40) promoter from pGL3-Promoter (Promega) into pRL-TK such that the SV40 promoter is driving the Renilla luciferase gene.
Proper citation: RRID:Addgene_27163 Copy
Species: Nematostella vectensis
Genetic Insert: Nv-NF-kB
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19806194
Comments: Clone starts at aa 2.
Proper citation: RRID:Addgene_27260 Copy
Species: Nematostella vectensis
Genetic Insert: Nv-NF-kB
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19806194
Comments: Clone starts at aa 2.
Proper citation: RRID:Addgene_27259 Copy
Species: Reticuloendotheliosis virus
Genetic Insert: v-Rel
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_27256 Copy
Species: Homo sapiens
Genetic Insert: REL
Vector Backbone Description: Backbone Size:3396; Vector Backbone:pSG424; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14534540
Proper citation: RRID:Addgene_27257 Copy
Species: Mus musculus
Genetic Insert: Trip6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10395914
Comments: Trip6 cDNA starts at aa 2.
Proper citation: RRID:Addgene_27254 Copy
Species: Homo sapiens
Genetic Insert: Trip6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10794523
Comments: Trip6 cDNA contains starts at aa 2.
Proper citation: RRID:Addgene_27255 Copy
Species: Homo sapiens
Genetic Insert: REL
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18695674
Proper citation: RRID:Addgene_27253 Copy
Species: Homo sapiens
Genetic Insert: prom PDE4D3
Vector Backbone Description: Backbone Size:4370; Vector Backbone:pGL4.11; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20952536
Proper citation: RRID:Addgene_27304 Copy
Species: Homo sapiens
Genetic Insert: bridging integrator 1 (BIN1), transcript variant 8
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pDEST/N1-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20169111
Proper citation: RRID:Addgene_27305 Copy
Species: Homo sapiens
Genetic Insert: Septin 5
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4985; Vector Backbone:pGEX6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18385322
Proper citation: RRID:Addgene_27269 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
