Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 23 showing 441 ~ 460 out of 164,548 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/81186

Species: Desulfovibrio vulgaris str. Hildenborough
Genetic Insert: Synthetic CRISPR array (3 copies of D. vulgaris spacer #2 flanked by repeats)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4008; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27588603
Comments: Spacer sequence: GCCATGCTCAGGCTGGCGAGTGCGCCACTCATCAA Repeat sequence: GTCGCCCCCCACGCGGGGGCGTGGATTGAAAC

Proper citation: RRID:Addgene_81186 Copy   


http://www.addgene.org/81163

Species: Synthetic
Genetic Insert: TEM-1 beta-lactamase
Vector Backbone Description: Backbone Size:3224; Vector Backbone:pSALECT; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28196882

Proper citation: RRID:Addgene_81163 Copy   


  • RRID:Addgene_113244

http://www.addgene.org/113244

Species: E. coli
Genetic Insert: IHFa F13A
Vector Backbone Description: Backbone Size:3600; Vector Backbone:pACYC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28729350

Proper citation: RRID:Addgene_113244 Copy   


  • RRID:Addgene_113320

http://www.addgene.org/113320

Species: Other
Genetic Insert: dCas9, MCP-TetD, J107 scRNA.b1_MS2
Vector Backbone Description: Vector Backbone:p15A vector; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29950558

Proper citation: RRID:Addgene_113320 Copy   


  • RRID:Addgene_113324

http://www.addgene.org/113324

Species: Other
Genetic Insert: dCas9 and MCP-SoxS_R93A
Vector Backbone Description: Vector Backbone:p15A vector; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29950558
Comments: Plasmid contains a G nucleotide deletion in the BBa_B1002 terminator sequence, which is not known to affect plasmid function.

Proper citation: RRID:Addgene_113324 Copy   


  • RRID:Addgene_113648

    This resource has 1+ mentions.

http://www.addgene.org/113648

Species: Other
Genetic Insert: ndmC
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/COGhnD32 . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.

Proper citation: RRID:Addgene_113648 Copy   


  • RRID:Addgene_113647

    This resource has 1+ mentions.

http://www.addgene.org/113647

Species: Other
Genetic Insert: ndmB
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/2C3Oh1ew . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.

Proper citation: RRID:Addgene_113647 Copy   


  • RRID:Addgene_113646

http://www.addgene.org/113646

Species: Other
Genetic Insert: ndmA
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/4vRm4arA . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.

Proper citation: RRID:Addgene_113646 Copy   


  • RRID:Addgene_113633

http://www.addgene.org/113633

Species: E. coli
Genetic Insert: Chloramphenicol resistance gene
Vector Backbone Description: Vector Backbone:pCas; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29884781

Proper citation: RRID:Addgene_113633 Copy   


  • RRID:Addgene_113651

    This resource has 1+ mentions.

http://www.addgene.org/113651

Species: Other
Genetic Insert: ndmB and ndmC
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/kNCaeGXO . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.

Proper citation: RRID:Addgene_113651 Copy   


  • RRID:Addgene_113652

    This resource has 1+ mentions.

http://www.addgene.org/113652

Species: Other
Genetic Insert: ndmA and ndmB and ndmC
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/xeoN8t6c . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.

Proper citation: RRID:Addgene_113652 Copy   


  • RRID:Addgene_114252

http://www.addgene.org/114252

Species: Synthetic
Genetic Insert: LacZalpha
Vector Backbone Description: Vector Backbone:pMXBC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29986052

Proper citation: RRID:Addgene_114252 Copy   


  • RRID:Addgene_114251

http://www.addgene.org/114251

Species: Synthetic
Genetic Insert: LacZalpha
Vector Backbone Description: Vector Backbone:pMXBC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29986052

Proper citation: RRID:Addgene_114251 Copy   


  • RRID:Addgene_114222

http://www.addgene.org/114222

Species: Synthetic
Genetic Insert: LacZalpha
Vector Backbone Description: Vector Backbone:pMXLC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29986052

Proper citation: RRID:Addgene_114222 Copy   


  • RRID:Addgene_114225

http://www.addgene.org/114225

Species: Synthetic
Genetic Insert: LacZalpha
Vector Backbone Description: Vector Backbone:pMXLC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29986052

Proper citation: RRID:Addgene_114225 Copy   


  • RRID:Addgene_114228

http://www.addgene.org/114228

Species: Synthetic
Genetic Insert: LacZalpha
Vector Backbone Description: Vector Backbone:pMXLC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29986052

Proper citation: RRID:Addgene_114228 Copy   


  • RRID:Addgene_114175

http://www.addgene.org/114175

Vector Backbone Description: Backbone Size:3196; Vector Backbone:pACYC184; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30462270
Comments: Accession Number MG649434, Alternative ID = pGT416 . Please visit https://www.biorxiv.org/content/early/2018/07/04/361626 for bioRxiv preprint.

Proper citation: RRID:Addgene_114175 Copy   


  • RRID:Addgene_114632

http://www.addgene.org/114632

Species: Other
Genetic Insert: dCas9-omega
Vector Backbone Description: Backbone Size:2574; Vector Backbone:p15a; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30272008

Proper citation: RRID:Addgene_114632 Copy   


http://www.addgene.org/115654

Species: Moraxella bovoculi
Genetic Insert: MbCas12a
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:2600; Vector Backbone:CmR/p15A; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30190307

Proper citation: RRID:Addgene_115654 Copy   


  • RRID:Addgene_111986

http://www.addgene.org/111986

Vector Backbone Description: Backbone Size:2787; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29724956

Proper citation: RRID:Addgene_111986 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X