Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Desulfovibrio vulgaris str. Hildenborough
Genetic Insert: Synthetic CRISPR array (3 copies of D. vulgaris spacer #2 flanked by repeats)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4008; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27588603
Comments: Spacer sequence: GCCATGCTCAGGCTGGCGAGTGCGCCACTCATCAA
Repeat sequence: GTCGCCCCCCACGCGGGGGCGTGGATTGAAAC
Proper citation: RRID:Addgene_81186 Copy
Species: Synthetic
Genetic Insert: TEM-1 beta-lactamase
Vector Backbone Description: Backbone Size:3224; Vector Backbone:pSALECT; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28196882
Proper citation: RRID:Addgene_81163 Copy
Species: E. coli
Genetic Insert: IHFa F13A
Vector Backbone Description: Backbone Size:3600; Vector Backbone:pACYC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28729350
Proper citation: RRID:Addgene_113244 Copy
Species: Other
Genetic Insert: dCas9, MCP-TetD, J107 scRNA.b1_MS2
Vector Backbone Description: Vector Backbone:p15A vector; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29950558
Proper citation: RRID:Addgene_113320 Copy
Species: Other
Genetic Insert: dCas9 and MCP-SoxS_R93A
Vector Backbone Description: Vector Backbone:p15A vector; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29950558
Comments: Plasmid contains a G nucleotide deletion in the BBa_B1002 terminator sequence, which is not known to affect plasmid function.
Proper citation: RRID:Addgene_113324 Copy
Species: Other
Genetic Insert: ndmC
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/COGhnD32 . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.
Proper citation: RRID:Addgene_113648 Copy
Species: Other
Genetic Insert: ndmB
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/2C3Oh1ew . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.
Proper citation: RRID:Addgene_113647 Copy
Species: Other
Genetic Insert: ndmA
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/4vRm4arA . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.
Proper citation: RRID:Addgene_113646 Copy
Species: E. coli
Genetic Insert: Chloramphenicol resistance gene
Vector Backbone Description: Vector Backbone:pCas; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29884781
Proper citation: RRID:Addgene_113633 Copy
Species: Other
Genetic Insert: ndmB and ndmC
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/kNCaeGXO . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.
Proper citation: RRID:Addgene_113651 Copy
Species: Other
Genetic Insert: ndmA and ndmB and ndmC
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/xeoN8t6c . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.
Proper citation: RRID:Addgene_113652 Copy
Species: Synthetic
Genetic Insert: LacZalpha
Vector Backbone Description: Vector Backbone:pMXBC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29986052
Proper citation: RRID:Addgene_114252 Copy
Species: Synthetic
Genetic Insert: LacZalpha
Vector Backbone Description: Vector Backbone:pMXBC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29986052
Proper citation: RRID:Addgene_114251 Copy
Species: Synthetic
Genetic Insert: LacZalpha
Vector Backbone Description: Vector Backbone:pMXLC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29986052
Proper citation: RRID:Addgene_114222 Copy
Species: Synthetic
Genetic Insert: LacZalpha
Vector Backbone Description: Vector Backbone:pMXLC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29986052
Proper citation: RRID:Addgene_114225 Copy
Species: Synthetic
Genetic Insert: LacZalpha
Vector Backbone Description: Vector Backbone:pMXLC; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29986052
Proper citation: RRID:Addgene_114228 Copy
Vector Backbone Description: Backbone Size:3196; Vector Backbone:pACYC184; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30462270
Comments: Accession Number MG649434, Alternative ID = pGT416 . Please visit https://www.biorxiv.org/content/early/2018/07/04/361626 for bioRxiv preprint.
Proper citation: RRID:Addgene_114175 Copy
Species: Other
Genetic Insert: dCas9-omega
Vector Backbone Description: Backbone Size:2574; Vector Backbone:p15a; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30272008
Proper citation: RRID:Addgene_114632 Copy
Species: Moraxella bovoculi
Genetic Insert: MbCas12a
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:2600; Vector Backbone:CmR/p15A; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30190307
Proper citation: RRID:Addgene_115654 Copy
Vector Backbone Description: Backbone Size:2787; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29724956
Proper citation: RRID:Addgene_111986 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.