Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: TALEN CCR5 Right (R18) Q3 C-term
Vector Backbone Description: Backbone Marker:Joung lab; Backbone Size:5055; Vector Backbone:JDS70; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24531420
Proper citation: RRID:Addgene_51441 Copy
Species: Synthetic
Genetic Insert: TALEN CCR5 Left (L18) Q3 C-term
Vector Backbone Description: Backbone Marker:Joung lab; Backbone Size:5055; Vector Backbone:JDS70; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24531420
Proper citation: RRID:Addgene_51440 Copy
Species: Synthetic
Genetic Insert: TALEN CCR5 Right (R18) N3 N-term
Vector Backbone Description: Backbone Marker:Joung lab; Backbone Size:5055; Vector Backbone:JDS70; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24531420
Proper citation: RRID:Addgene_51449 Copy
Species: Synthetic
Genetic Insert: TALEN CCR5 Left (L18) N3 N-term
Vector Backbone Description: Backbone Marker:Joung lab; Backbone Size:5055; Vector Backbone:JDS70; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24531420
Proper citation: RRID:Addgene_51448 Copy
Species: Synthetic
Genetic Insert: TALEN CCR5 Left (L18) N1 N-term
Vector Backbone Description: Backbone Marker:Joung lab; Backbone Size:5055; Vector Backbone:JDS70; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24531420
Proper citation: RRID:Addgene_51446 Copy
Species: Synthetic
Genetic Insert: Replacing the cpc operon with kanamycin resistance
Vector Backbone Description: Backbone Marker:DNA2.0; Backbone Size:4835; Vector Backbone:pJ207; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25046143
Comments: Formighieri C, Melis A (2015) A phycocyanin·phellandrene synthase fusion enhances recombinant protein expression and β-phellandrene (monoterpene) hydrocarbons production in Synechocystis (cyanobacteria). Metab Eng 32:116–124. http://dx.doi.org/10.1016/j.ymben.2015.09.010
Proper citation: RRID:Addgene_51468 Copy
Species: Synthetic
Genetic Insert: Quasar2-mOrange-Chr64-GFP
Vector Backbone Description: Vector Backbone:lentivirus backbone; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_51656 Copy
Species: Synthetic
Genetic Insert: superfolder GFP
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23893733
Comments: The sfGFP in this plasmid contains Y148C and K214I mutations that do not affect the function of the plasmid.
Proper citation: RRID:Addgene_51559 Copy
Species: Synthetic
Genetic Insert: superfolder GFP
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pTXB1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_51562 Copy
Species: Synthetic
Genetic Insert: Codon-optimized Cas9 D10A
Vector Backbone Description: Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24491566
Comments: This plasmid vector was constructed by mutation PCR of pCAG-T3-hCAS9-pA plasmid vector (Addgene plasmid 48625) using the primers (Forward primer, 5’-AGTACTCCATTGGGCTCGccATCGGCACAAAC, and Reverse primer, 5’-CGAGCCCAATGGAGTACTTCTTGTCGGCTGC).
For the in vitro synthesis of CAS9 D10A mRNAs, the vector was linearized by SphI and in-vitro transcribed using T3-RNA-polymerase (Promega) in the presence of m7G(5′)ppp(5′)G to synthesize capped RNA.
The Tbpl1 3′UTR 95 nucleotide polyA tail at the 3' end of the insert allows in vitro transcribed mRNA from this plasmid to be used directly for microinjection into animal embryos or oocytes without additional polyadenylation treatment.
The CAG promoter in this plasmid also allows it to be used as a CAS9-expression vector.
Proper citation: RRID:Addgene_51638 Copy
Species: Synthetic
Genetic Insert: SpyLigase
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:6400; Vector Backbone:pDEST14; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24639550
Comments: SnoopLigase is the more recent peptide-peptide ligation technology from the Howarth lab and is now preferred over SpyLigase in terms of more general reaction conditions and higher coupling yield on a range of proteins.
pET28a-AviTag-SnoopLigase https://www.addgene.org/105626/
pET28a-HaloTag7-SnoopLigase https://www.addgene.org/105627/
SpyLigase peptide-peptide ligation polymerizes affibodies to enhance magnetic cancer cell capture. Jacob O. Fierer, Gianluca Veggiani and Mark Howarth
Transform plasmid into BL21 DE3 RIPL for expression.
Proper citation: RRID:Addgene_51722 Copy
Species: Synthetic
Genetic Insert: Optopatch2
Vector Backbone Description: Backbone Marker:Pavel Osten; Backbone Size:9236; Vector Backbone:FCK(1.3); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24952910
Proper citation: RRID:Addgene_51694 Copy
Species: Synthetic
Genetic Insert: Optopatch1
Vector Backbone Description: Backbone Marker:Pavel Osten; Backbone Size:9236; Vector Backbone:FCK(1.3); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24952910
Proper citation: RRID:Addgene_51695 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336571
Comments: gRNA target sequence GGCCACAAGTTCAGCGTGTC
These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids.
Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.
Proper citation: RRID:Addgene_51762 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Zhang lab; Vector Backbone:lentiCRISPR (pXPR_001), Addgene plasmid #49535; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336571
Comments: gRNA target sequence GGAGCGCACCATCTTCTTCA
These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids.
Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.
Proper citation: RRID:Addgene_51763 Copy
Species: Synthetic
Genetic Insert: Sirius
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19349978
Comments: GenBank accession number: AB444952
Proper citation: RRID:Addgene_51956 Copy
Species: Synthetic
Genetic Insert: ATeam1.03-nD/nA
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20047338
Proper citation: RRID:Addgene_51960 Copy
Species: Synthetic
Genetic Insert: Yellow Cameleon-Nano15
Vector Backbone Description: Vector Backbone:pBig delta BamHI; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20693999
Comments: The vector pBIG is derived from the published construct pATANB43 (Dynes and Firtel, 1989). pBIG contains a 5.9 kb fragment of the native Dictyostelium extrachromosomal plasmid Ddpl that confers autonomous replication in Dictyostelium, a 2.2 kb actm 6 promoter-G418-resistant gene cartridge, and vector sequences from pBluescript (11) SK (Stratagene). (reference: Cell, Vol 75, Issue 2, 1993, 361-371).
Proper citation: RRID:Addgene_51962 Copy
Species: Synthetic
Genetic Insert: Nano-lantern
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23232392
Comments: GenBank accession number: JN859492. The improved brightness of Nano-lantern should generate power densities in the range of 1μW/cm2 (versus 0.1μW/cm2 for RLuc8) following transient overexpression in the micromolar range in human cells, and thus increase imaging potential.
Proper citation: RRID:Addgene_51969 Copy
Species: Synthetic
Genetic Insert: Nano-lantern
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23232392
Comments: GenBank accession number: JN859492
The minor discrepancies between the QC and depositor sequence have no functional consequence.
Proper citation: RRID:Addgene_51971 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
