Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Corynactis sp.
Genetic Insert: Red fluorescent protein
Vector Backbone Description: Backbone Marker:DNA20; Backbone Size:3929; Vector Backbone:pJ401; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: Alternative name: p005-kan-RFP-T5lac Please visit https://www.biorxiv.org/content/10.1101/2021.06.20.449138v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_58533 Copy
Genetic Insert: Cyc1 terminator
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_58562 Copy
Species: Homo sapiens
Genetic Insert: PDB:4NW3
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/4NW3/
Proper citation: RRID:Addgene_58752 Copy
Species: Homo sapiens
Genetic Insert: ALKBH5
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/4O61/
http://www.thesgc.org/structures/4OCT/
Proper citation: RRID:Addgene_58754 Copy
Species: Homo sapiens
Genetic Insert: PDB:4NW2
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/4NW2/
http://www.thesgc.org/structures/4O42/
Proper citation: RRID:Addgene_58755 Copy
Species: Homo sapiens
Genetic Insert: PDB:4O62
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/4O62/
Proper citation: RRID:Addgene_58758 Copy
Species: Homo sapiens
Genetic Insert: PDB:4PWY
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/4PWY/
Proper citation: RRID:Addgene_58761 Copy
Species: Aquorea victoria
Genetic Insert: Green fluorescent protein
Vector Backbone Description: Backbone Marker:DNA2.0; Backbone Size:3976; Vector Backbone:pJ401; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: Alternative name: p006-kan-GFP-T5lac Please visit https://www.biorxiv.org/content/10.1101/2021.06.20.449138v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_58534 Copy
Species: Mus musculus
Genetic Insert: Smo
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5369; Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17641202
Proper citation: RRID:Addgene_58703 Copy
Species: Clostridium thermocellum
Genetic Insert: CBM-CohI
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5216; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25194847
Proper citation: RRID:Addgene_58709 Copy
Species: Synthetic
Genetic Insert: sfGFP-DocI
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5216; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25194847
Proper citation: RRID:Addgene_58708 Copy
Species: Synthetic
Genetic Insert: Spec(x2)-DocI
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5216; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25194847
Proper citation: RRID:Addgene_58713 Copy
Species: Homo sapiens
Genetic Insert: TEM4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22911862
Comments: Please note that the Addgene verified sequence identified a L722F mutation in TEM4. It is unknown whether this mutation affects protein function.
Proper citation: RRID:Addgene_58895 Copy
Species: Homo sapiens
Genetic Insert: TEM4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22911862
Proper citation: RRID:Addgene_58894 Copy
Species: Danio rerio
Genetic Insert: zebrafish lymphocyte-specific protein tyrosine kinase (lck) promoter, 7.4 kb
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4777; Vector Backbone:pDONR P4-P1R; Vector Types:Gateway 5' entry clone; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_58891 Copy
Species: Homo sapiens
Genetic Insert: TEM4
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22911862
Comments: Please note that the Addgene verified sequence identified a L722F mutation in TEM4. It is unknown whether this mutation affects protein function.
Proper citation: RRID:Addgene_58893 Copy
Species: Caenorhabditis elegans
Genetic Insert: avr-15 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24879462
Comments: gRNA target sequence GTTTGCAATATAAGTCACCC
Proper citation: RRID:Addgene_58982 Copy
Species: Homo sapiens
Genetic Insert: CAMSAP2 CKK domain
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24706919
Proper citation: RRID:Addgene_59032 Copy
Species: Homo sapiens
Genetic Insert: CAMSAP1 CKK domain
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24706919
Proper citation: RRID:Addgene_59031 Copy
Species: Caenorhabditis elegans
Genetic Insert: avr-14 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24879462
Comments: gRNA target sequence GATTGGAGAGTTAGACCACG
Proper citation: RRID:Addgene_58981 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
