Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Size:5004; Vector Backbone:Unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39244484
Comments: Low copy plasmid (pSC101 ori and repA), pUC18 MCS, confers streptomycin resistance
Proper citation: RRID:Addgene_225175 Copy
Vector Backbone Description: Backbone Size:5007; Vector Backbone:pHBJT023; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39244484
Comments: pHBJT023 containing IPTG-inducible mCherry
Proper citation: RRID:Addgene_225180 Copy
Species: Homo sapiens
Genetic Insert: Human liver pyruvate kinase
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4290; Vector Backbone:pCDF-Duet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37171062
Comments: Expression and purification of an exogenous PYK requires the E. coli strain QTF60, a BL21-derivative lacking both endogenous PYK genes (pykF and pykA).
Proper citation: RRID:Addgene_220231 Copy
Species: Homo sapiens
Genetic Insert: P53 gene
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:33263541
Proper citation: RRID:Addgene_174042 Copy
Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31092918
Comments: The compressed genome of Syn61 was designed by systematically replacing the TCG, TCA, and TAG codons with their synonyms AGC, AGT, and TAA, respectively, in all open reading frames.
Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain:
GE282 AAAAAGGTCGGGCCGGACGGTC
GE283 GCAATAATGGCAGCCACACCTTG
Proper citation: RRID:Addgene_174513 Copy
Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons in the open reading frames and deleted serT, serU and prfA genes
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34083482
Comments: From the Syn61 strain (Addgene #174513), two rounds of parallel mutagenesis and dynamic selection were followed by deletion of the serT, serU and prfA genes, and a further three rounds of parallel mutagenesis and dynamic selection yielded Syn61Δ3(ev5) (Addgene #174514).
Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain:
GE282 AAAAAGGTCGGGCCGGACGGTC
GE283 GCAATAATGGCAGCCACACCTTG
Genotyping for deletion of serU gene:
GE1147 TACGAATGATGCCTCGCCGCAAATAAG
GE1148 CCTCACGCAACGGAATAAAGGGAACTC
Genotyping for deletion of serT gene:
GE1215 AGCGTCAGGCTCAGCAGAAAATAGG
GE1216 ACGTCCCTGTAGCAAGGCAAACCATC
Genotyping for deletion of prfA gene:
v13-1011 GACTAACCGCTTGATCCATGCGC
v13-1012 CAAGTTGCTGACATTGTTCGTCAGTCAGC
Proper citation: RRID:Addgene_174514 Copy
Species: Homo sapiens
Genetic Insert: EloB (1-104) and EloC (17-112)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDF-1b DUET; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28591624
Comments: Gadd MS, Testa A, Lucas X, Chan KH, Chen W, Lamont DJ, Zengerle M, Ciulli A. Structural basis of PROTAC cooperative recognition for selective protein degradation. Nat Chem Biol. 2017 May;13(5):514-521. doi: 10.1038/nchembio.2329. Epub 2017 Mar 13. PMID: 28288108; PMCID: PMC5392356.
Proper citation: RRID:Addgene_204501 Copy
Species: Synthetic
Genetic Insert: type IC dsDNA target
Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36805026
Proper citation: RRID:Addgene_196399 Copy
Species: Dyadobacter crusticola DSM 16708
Genetic Insert: DybH
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:41911463
Comments: Please visit https://doi.org/10.1101/2025.10.31.685832 for bioRxiv preprint.
Proper citation: RRID:Addgene_257761 Copy
Species: Chitinophaga sancti DSM 784
Genetic Insert: ChsH
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:41911463
Comments: Please visit https://doi.org/10.1101/2025.10.31.685832 for bioRxiv preprint.
Proper citation: RRID:Addgene_257762 Copy
Species: E. coli
Genetic Insert: holE
Vector Backbone Description: Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_241264 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: hk/P-RFA3
Vector Backbone Description: Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_240743 Copy
Species: Homo sapiens
Genetic Insert: ABL2
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific Inc.; Backbone Size:4761; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Streptomycin
Defining Citation: PMID:40419795
Proper citation: RRID:Addgene_215468 Copy
Species: Homo sapiens
Genetic Insert: ABL2
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Streptomycin
Defining Citation: PMID:40419795
Proper citation: RRID:Addgene_215467 Copy
Species: bacteria
Genetic Insert: Promotorless gfp reporter gene
Vector Backbone Description: Vector Backbone:pBBR1; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:11059491
Comments: Please refer to the attached table for a complete list of restriction sites in the MCS.
Proper citation: RRID:Addgene_37821 Copy
Species: Synthetic
Genetic Insert: LacI-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_172559 Copy
Species: Synthetic
Genetic Insert: CymRAM-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_172558 Copy
Species: Synthetic
Genetic Insert: LacI-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_172562 Copy
Species: Synthetic
Genetic Insert: LuxR-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_172560 Copy
Species: Homo sapiens
Genetic Insert: CD147
Vector Backbone Description: Vector Backbone:pENTR223; Vector Types:Gateway Cloning; Bacterial Resistance:Streptomycin
Comments: cloned from cDNA generated from mRNA of human BJ cells (ATCC CRL-2522) by reverse transcription
Proper citation: RRID:Addgene_149720 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
