Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:streptomycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

228 Results - per page

Show More Columns | Download 228 Result(s)

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pAW212
 
Resource Report
Resource Website 		RRID:Addgene_113234 Cas1 E. coli Streptomycin PMID:28729350 Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-29 12:51:52 0
pAW216
 
Resource Report
Resource Website 		RRID:Addgene_113238 Cas1 E. coli Streptomycin PMID:28729350 Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-29 12:51:52 0
pAW156
 
Resource Report
Resource Website 		RRID:Addgene_113185 Cas1 E. coli Streptomycin PMID:28729350 Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin K259E 2026-08-29 12:51:51 0
pAW210
 
Resource Report
Resource Website 		RRID:Addgene_113189 Cas1 E. coli Streptomycin PMID:28729350 Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin H208A 2026-08-29 12:51:51 0
pAW188
 
Resource Report
Resource Website 		RRID:Addgene_113178 Cas1 E. coli Streptomycin PMID:28729350 Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin R131A 2026-08-29 12:51:51 0
pAW158
 
Resource Report
Resource Website 		RRID:Addgene_113177 Cas1 E. coli Streptomycin PMID:28729350 Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin R112E 2026-08-29 12:51:51 0
pAW152
 
Resource Report
Resource Website 		RRID:Addgene_113175 Cas1 E. coli Streptomycin PMID:28729350 Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin K12E 2026-08-29 12:51:51 0
pAW185
 
Resource Report
Resource Website 		RRID:Addgene_113179 Cas1 E. coli Streptomycin PMID:28729350 Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin R132A 2026-08-29 12:51:51 0
pAW189
 
Resource Report
Resource Website 		RRID:Addgene_113180 Cas1 E. coli Streptomycin PMID:28729350 Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin Q136A 2026-08-29 12:51:51 0
pCDF RBP-FL P53
 
Resource Report
Resource Website 		RRID:Addgene_174042 P53 gene Homo sapiens Streptomycin PMID:33263541 Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-29 01:00:24 0
Syn61
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_174513 Recoded E. coli strain without TCG, TCA, or TAG codons Streptomycin PMID:31092918 The compressed genome of Syn61 was designed by systematically replacing the TCG, TCA, and TAG codons with their synonyms AGC, AGT, and TAA, respectively, in all open reading frames. Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain: GE282 AAAAAGGTCGGGCCGGACGGTC GE283 GCAATAATGGCAGCCACACCTTG Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-29 01:00:28 3
Syn61Δ3(ev5)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_174514 Recoded E. coli strain without TCG, TCA, or TAG codons in the open reading frames and deleted serT, serU and prfA genes Streptomycin PMID:34083482 From the Syn61 strain (Addgene #174513), two rounds of parallel mutagenesis and dynamic selection were followed by deletion of the serT, serU and prfA genes, and a further three rounds of parallel mutagenesis and dynamic selection yielded Syn61Δ3(ev5) (Addgene #174514). Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain: GE282 AAAAAGGTCGGGCCGGACGGTC GE283 GCAATAATGGCAGCCACACCTTG Genotyping for deletion of serU gene: GE1147 TACGAATGATGCCTCGCCGCAAATAAG GE1148 CCTCACGCAACGGAATAAAGGGAACTC Genotyping for deletion of serT gene: GE1215 AGCGTCAGGCTCAGCAGAAAATAGG GE1216 ACGTCCCTGTAGCAAGGCAAACCATC Genotyping for deletion of prfA gene: v13-1011 GACTAACCGCTTGATCCATGCGC v13-1012 CAAGTTGCTGACATTGTTCGTCAGTCAGC Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin 2026-08-29 01:00:28 2
pECO300
 
Resource Report
Resource Website 		RRID:Addgene_169766 Streptomycin PMID:32190101 Vector Backbone:pHAtC; Vector Types:Plant Expression, Plant Binary vector; Bacterial Resistance:Streptomycin 2026-08-29 12:59:52 0
pDLlR6
 
Resource Report
Resource Website 		RRID:Addgene_172559 LacI-mRFP Synthetic Streptomycin Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin 2026-08-29 01:00:13 0
pDCyR6
 
Resource Report
Resource Website 		RRID:Addgene_172558 CymRAM-mRFP Synthetic Streptomycin Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin 2026-08-29 01:00:13 0
pELlR6
 
Resource Report
Resource Website 		RRID:Addgene_172562 LacI-mRFP Synthetic Streptomycin Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin 2026-08-29 01:00:13 0
pDLxR6
 
Resource Report
Resource Website 		RRID:Addgene_172560 LuxR-mRFP Synthetic Streptomycin Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin 2026-08-29 01:00:13 0
pWUR790
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_101723 PfAgo Pyrococcus furiosus Streptomycin PMID:25925567 Backbone Marker:Novagen; Backbone Size:3621; Vector Backbone:pCDF-1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-29 12:50:04 1
HB101 endA::frt
 
Resource Report
Resource Website 		RRID:Addgene_45473 endA::frt Streptomycin PMID:21306445 endA was deleted for cleaner and higher yield plasmid preps. Vector Backbone:N/A; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin major endonuclease endA deleted 2026-08-29 01:05:57 0
pTDpelB-CTwinStrep
 
Resource Report
Resource Website 		RRID:Addgene_45941 Streptomycin PMID:23687945 This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-29 01:05:55 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The PRECISE-TBI toolbox are a collection tools and resources to increase rigor and reproducibility with Traumatic Brain Injury within the PRE Clinical Interagency reSearch resourcE - Traumatic Brain Injury (PRECISE-TBI). Please learn more about PRECISE-TBI at https://www.precise-tbi.org

Recent News Entries

Contact Us

Department of Neurosciences, School of Medicine

University of California, San Diego





About SciCrunch | Privacy Policy | Terms of Service

SciCrunch