Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons in the open reading frames and deleted serT, serU and prfA genes
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34083482
Comments: From the Syn61 strain (Addgene #174513), two rounds of parallel mutagenesis and dynamic selection were followed by deletion of the serT, serU and prfA genes, and a further three rounds of parallel mutagenesis and dynamic selection yielded Syn61Δ3(ev5) (Addgene #174514).
Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain:
GE282 AAAAAGGTCGGGCCGGACGGTC
GE283 GCAATAATGGCAGCCACACCTTG
Genotyping for deletion of serU gene:
GE1147 TACGAATGATGCCTCGCCGCAAATAAG
GE1148 CCTCACGCAACGGAATAAAGGGAACTC
Genotyping for deletion of serT gene:
GE1215 AGCGTCAGGCTCAGCAGAAAATAGG
GE1216 ACGTCCCTGTAGCAAGGCAAACCATC
Genotyping for deletion of prfA gene:
v13-1011 GACTAACCGCTTGATCCATGCGC
v13-1012 CAAGTTGCTGACATTGTTCGTCAGTCAGC
Proper citation: RRID:Addgene_174514 Copy
Species: Homo sapiens
Genetic Insert: EloB (1-104) and EloC (17-112)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDF-1b DUET; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28591624
Comments: Gadd MS, Testa A, Lucas X, Chan KH, Chen W, Lamont DJ, Zengerle M, Ciulli A. Structural basis of PROTAC cooperative recognition for selective protein degradation. Nat Chem Biol. 2017 May;13(5):514-521. doi: 10.1038/nchembio.2329. Epub 2017 Mar 13. PMID: 28288108; PMCID: PMC5392356.
Proper citation: RRID:Addgene_204501 Copy
Species: Synthetic
Genetic Insert: type IC dsDNA target
Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36805026
Proper citation: RRID:Addgene_196399 Copy
Species: Synthetic
Genetic Insert: Zea mays FNR and Z. mays SIR
Vector Backbone Description: Vector Backbone:P15a; Vector Types:Synthetic Biology; Bacterial Resistance:Streptomycin
Comments: For detailed annotations see the GenBank file under Resource Information/Supplemental Documents. Please visit https://www.biorxiv.org/content/10.1101/645978v1 for BioRxiv preprint
Proper citation: RRID:Addgene_131805 Copy
Species: Arabidopsis thaliana
Genetic Insert: PhyB(1-651)-AviTag-His6
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:33659515
Proper citation: RRID:Addgene_131864 Copy
Species: Arabidopsis thaliana
Genetic Insert: PhyB(1-651)-RGD-His6-Cys
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31526004
Proper citation: RRID:Addgene_131862 Copy
Genetic Insert: tetR(sB)
Vector Backbone Description: Backbone Size:5127; Vector Backbone:pDE43-MCSq17; Vector Types:Bacterial Expression, Gateway Cloning; Bacterial Resistance:Streptomycin
Defining Citation: PMID:21203517
Proper citation: RRID:Addgene_27364 Copy
Genetic Insert: endA::frt
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:21306445
Comments: endA was deleted for cleaner and higher yield plasmid preps.
Proper citation: RRID:Addgene_45473 Copy
Vector Backbone Description: Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23687945
Comments: This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates.
The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long
Proper citation: RRID:Addgene_45941 Copy
Species: Aequorea victoria
Genetic Insert: synthetic sfYFP (codon usage adapted to P.putida KT2440)
Vector Backbone Description: Backbone Marker:Dammeyer et al. 2013; Vector Backbone:pTD-CTwinStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23687945
Comments: This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates.
The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long
Proper citation: RRID:Addgene_45943 Copy
Species: Aequorea victoria
Genetic Insert: synthetic eYFP (codon usage adapted to E.coli K12)
Vector Backbone Description: Backbone Marker:Dammeyer et al. 2013; Vector Backbone:pTD-CTwinStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23687945
Comments: This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates.
The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long
Proper citation: RRID:Addgene_45942 Copy
Species: bacteria
Genetic Insert: Promotorless gfp reporter gene
Vector Backbone Description: Vector Backbone:pBBR1; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:11059491
Comments: Please refer to the attached table for a complete list of restriction sites in the MCS.
Proper citation: RRID:Addgene_37821 Copy
Vector Backbone Description: Vector Backbone:genome; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:22822084
Comments: selection using 10-15 micrograms/mL strep.
It is MalE deficient, which enables maltose complementation. For the assay, a particular construct is transformed into MM39 and grown on maltose minimal media to confirm proper membrane orientation and integration.
Proper citation: RRID:Addgene_42894 Copy
Species: E. coli
Genetic Insert: DH10β atpi:slr0214:gidB
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39846505
Comments: Strain has resistance to streptomycin but not spectinomycin, use spectinomycin 100 µg/mL for plasmids with a streptomycin resistance cassette.
This strain methylates the first cytosine in the palindrome CGATCG.
Proper citation: RRID:Addgene_226851 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RFC5
Vector Backbone Description: Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_239202 Copy
Species: Anthoceros agrestis
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Removal of Anthoceros agrestis Raf2 from pCDF_AaRaf1/Raf2/BSD2 was performed by Genscript.
Proper citation: RRID:Addgene_229516 Copy
Species: Anthoceros agrestis
Genetic Insert: Rubisco accumulation factor 2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Removal of Anthoceros agrestis Raf1 from pCDF_AaRaf1/Raf2/RbcX2/BSD2/RbcX1 was performed by Genscript.
Proper citation: RRID:Addgene_229512 Copy
Species: Anthoceros agrestis
Genetic Insert: Rubisco accumulation factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39491367
Comments: Removal of Anthoceros agrestis BSD2from pCDF_AaRaf1/Raf2/RbcX2/BSD2/RbcX1 was performed by Genscript.
Proper citation: RRID:Addgene_229514 Copy
Species: Other
Genetic Insert: Scream2
Vector Backbone Description: Backbone Marker:Sylvestre Marillonnet; Backbone Size:5201; Vector Backbone:pAGM8031; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39943924
Proper citation: RRID:Addgene_215191 Copy
Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression, Golden-Gate Acceptor; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39622624
Comments: Contains ccdB.
Please visit https://doi.org/10.1101/2024.06.17.599261 for bioRxiv preprint.
Proper citation: RRID:Addgene_223853 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
