Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: CD147
Vector Backbone Description: Vector Backbone:pENTR223; Vector Types:Gateway Cloning; Bacterial Resistance:Streptomycin
Comments: cloned from cDNA generated from mRNA of human BJ cells (ATCC CRL-2522) by reverse transcription
Proper citation: RRID:Addgene_149720 Copy
Species: Homo sapiens
Genetic Insert: TMPRSS2
Vector Backbone Description: Vector Backbone:pENTR223; Vector Types:Gateway Cloning; Bacterial Resistance:Streptomycin
Comments: HQ448630
Proper citation: RRID:Addgene_149721 Copy
Species: SARS-CoV-2 isolate Wuhan-Hu
Genetic Insert: NSP7
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF Duet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:32783916
Comments: Please visit https://doi.org/10.1101/2020.07.08.194084 for bioRxiv preprint.
Proper citation: RRID:Addgene_159092 Copy
Species: Homo sapiens
Genetic Insert: MKK6
Vector Backbone Description: Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28174228
Proper citation: RRID:Addgene_82718 Copy
Species: Homo sapiens
Genetic Insert: MKK6
Vector Backbone Description: Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28174228
Proper citation: RRID:Addgene_82719 Copy
Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137
Proper citation: RRID:Addgene_89728 Copy
Species: Mus musculus
Genetic Insert: TET1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3780; Vector Backbone:pCDF-Duet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:26932196
Proper citation: RRID:Addgene_81052 Copy
Genetic Insert: pGH3.17::SMT2-FLAG
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170844 Copy
Genetic Insert: pUBQ10::SMT2-FLAG::tOCS
Vector Backbone Description: Vector Backbone:pFP100; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170842 Copy
Genetic Insert: pFRO6::SMT2-FLAG
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please note that the Addgene verified sequence differs from the depositor reference sequence linked in the supplemental documents section. These differences did not impact plasmid function. The primers 5' - ATCCAAGCTCAAGCTAAGCTcgatgctctcaaggccaa and 3' -TATCTCATTAAAGCAGGATCCTCACTTGTCATCGTCGTCCTTGTAATCAGAACTCTCCTCCGGT were previously used, although the 5' primer differs slightly from the Addgene verified sequence.
Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170843 Copy
Genetic Insert: GH3.17p
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170841 Copy
Genetic Insert: n/a
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Comments: This strain has 1059 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110015 and the accompanying paper for more details.
Proper citation: RRID:Addgene_201051 Copy
Genetic Insert: n/a
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Comments: This strain has 797 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110016 and the accompanying paper for more details.
Proper citation: RRID:Addgene_201050 Copy
Species: Zea mays (maize)
Genetic Insert: NCH1
Vector Backbone Description: Backbone Size:11546; Vector Backbone:pH7WG2; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:33679862
Proper citation: RRID:Addgene_131017 Copy
Species: E. coli
Genetic Insert: DH10β atpi:slr0214:gidB
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39846505
Comments: Strain has resistance to streptomycin but not spectinomycin, use spectinomycin 100 µg/mL for plasmids with a streptomycin resistance cassette.
This strain methylates the first cytosine in the palindrome CGATCG.
Proper citation: RRID:Addgene_226851 Copy
Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression, Golden-Gate Acceptor; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39622624
Comments: Contains ccdB.
Please visit https://doi.org/10.1101/2024.06.17.599261 for bioRxiv preprint.
Proper citation: RRID:Addgene_223853 Copy
Species: Other
Genetic Insert: Scream2
Vector Backbone Description: Backbone Marker:Sylvestre Marillonnet; Backbone Size:5201; Vector Backbone:pAGM8031; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39943924
Proper citation: RRID:Addgene_215191 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RFC5
Vector Backbone Description: Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_239202 Copy
Species: Synthetic
Genetic Insert: Cas9-sgRNA-homology arms
Vector Backbone Description: Vector Backbone:pJRD215; Vector Types:Bacterial Expression, CRISPR, broad-host-range; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37556825
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.03.14.484339v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_184908 Copy
Vector Backbone Description: Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:35998606
Comments: Please note that Addgene's NGS found a 65bp insertion in the ori region as compared to the Depositor's sequence. The depositor has confirmed that the plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_188979 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
