Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 10 showing 181 ~ 200 out of 228 results
Snippet view Table view Download 228 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_126503

http://www.addgene.org/126503

Species: Pseudomonas aeruginosa SG17M
Genetic Insert: disaggregase ClpGgi with 6xHis-tag
Vector Backbone Description: Backbone Size:6055; Vector Backbone:pJN105; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:29263094
Comments: conditional Biosafety Level 2 if expressed in Pseudomonas aeruginosa SG17M

Proper citation: RRID:Addgene_126503 Copy   


http://www.addgene.org/132736

Species: Synthetic
Genetic Insert: PluxB_ToeRep_N01_trigger
Vector Backbone Description: Backbone Size:3235; Vector Backbone:pCDFduet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31686032
Comments: Please visit https://www.biorxiv.org/content/10.1101/501783v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_132736 Copy   


  • RRID:Addgene_113185

http://www.addgene.org/113185

Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350

Proper citation: RRID:Addgene_113185 Copy   


  • RRID:Addgene_113189

http://www.addgene.org/113189

Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350

Proper citation: RRID:Addgene_113189 Copy   


  • RRID:Addgene_113178

http://www.addgene.org/113178

Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350

Proper citation: RRID:Addgene_113178 Copy   


  • RRID:Addgene_113177

http://www.addgene.org/113177

Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350

Proper citation: RRID:Addgene_113177 Copy   


  • RRID:Addgene_113175

http://www.addgene.org/113175

Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350

Proper citation: RRID:Addgene_113175 Copy   


  • RRID:Addgene_113179

http://www.addgene.org/113179

Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350

Proper citation: RRID:Addgene_113179 Copy   


  • RRID:Addgene_113180

http://www.addgene.org/113180

Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350

Proper citation: RRID:Addgene_113180 Copy   


  • RRID:Addgene_113242

http://www.addgene.org/113242

Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350

Proper citation: RRID:Addgene_113242 Copy   


  • RRID:Addgene_113241

http://www.addgene.org/113241

Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350

Proper citation: RRID:Addgene_113241 Copy   


  • RRID:Addgene_113233

http://www.addgene.org/113233

Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350

Proper citation: RRID:Addgene_113233 Copy   


  • RRID:Addgene_113234

http://www.addgene.org/113234

Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350

Proper citation: RRID:Addgene_113234 Copy   


  • RRID:Addgene_113238

http://www.addgene.org/113238

Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350

Proper citation: RRID:Addgene_113238 Copy   


  • RRID:Addgene_172559

http://www.addgene.org/172559

Species: Synthetic
Genetic Insert: LacI-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin

Proper citation: RRID:Addgene_172559 Copy   


  • RRID:Addgene_172558

http://www.addgene.org/172558

Species: Synthetic
Genetic Insert: CymRAM-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin

Proper citation: RRID:Addgene_172558 Copy   


  • RRID:Addgene_172562

http://www.addgene.org/172562

Species: Synthetic
Genetic Insert: LacI-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin

Proper citation: RRID:Addgene_172562 Copy   


  • RRID:Addgene_172560

http://www.addgene.org/172560

Species: Synthetic
Genetic Insert: LuxR-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin

Proper citation: RRID:Addgene_172560 Copy   


  • RRID:Addgene_174042

http://www.addgene.org/174042

Species: Homo sapiens
Genetic Insert: P53 gene
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:33263541

Proper citation: RRID:Addgene_174042 Copy   


  • RRID:Addgene_174513

    This resource has 1+ mentions.

http://www.addgene.org/174513

Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31092918
Comments: The compressed genome of Syn61 was designed by systematically replacing the TCG, TCA, and TAG codons with their synonyms AGC, AGT, and TAA, respectively, in all open reading frames. Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain: GE282 AAAAAGGTCGGGCCGGACGGTC GE283 GCAATAATGGCAGCCACACCTTG

Proper citation: RRID:Addgene_174513 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. PRECISE-TBI Resources

    Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within PRECISE-TBI that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X