Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Pseudomonas aeruginosa SG17M
Genetic Insert: disaggregase ClpGgi with 6xHis-tag
Vector Backbone Description: Backbone Size:6055; Vector Backbone:pJN105; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:29263094
Comments: conditional Biosafety Level 2 if expressed in Pseudomonas aeruginosa SG17M
Proper citation: RRID:Addgene_126503 Copy
Species: Synthetic
Genetic Insert: PluxB_ToeRep_N01_trigger
Vector Backbone Description: Backbone Size:3235; Vector Backbone:pCDFduet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31686032
Comments: Please visit https://www.biorxiv.org/content/10.1101/501783v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_132736 Copy
Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350
Proper citation: RRID:Addgene_113185 Copy
Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350
Proper citation: RRID:Addgene_113189 Copy
Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350
Proper citation: RRID:Addgene_113178 Copy
Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350
Proper citation: RRID:Addgene_113177 Copy
Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350
Proper citation: RRID:Addgene_113175 Copy
Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350
Proper citation: RRID:Addgene_113179 Copy
Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350
Proper citation: RRID:Addgene_113180 Copy
Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350
Proper citation: RRID:Addgene_113242 Copy
Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350
Proper citation: RRID:Addgene_113241 Copy
Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350
Proper citation: RRID:Addgene_113233 Copy
Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350
Proper citation: RRID:Addgene_113234 Copy
Species: E. coli
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:28729350
Proper citation: RRID:Addgene_113238 Copy
Species: Synthetic
Genetic Insert: LacI-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_172559 Copy
Species: Synthetic
Genetic Insert: CymRAM-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_172558 Copy
Species: Synthetic
Genetic Insert: LacI-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_172562 Copy
Species: Synthetic
Genetic Insert: LuxR-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_172560 Copy
Species: Homo sapiens
Genetic Insert: P53 gene
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:33263541
Proper citation: RRID:Addgene_174042 Copy
Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31092918
Comments: The compressed genome of Syn61 was designed by systematically replacing the TCG, TCA, and TAG codons with their synonyms AGC, AGT, and TAA, respectively, in all open reading frames.
Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain:
GE282 AAAAAGGTCGGGCCGGACGGTC
GE283 GCAATAATGGCAGCCACACCTTG
Proper citation: RRID:Addgene_174513 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the PRECISE-TBI Resources search. From here you can search through a compilation of resources used by PRECISE-TBI and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that PRECISE-TBI has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on PRECISE-TBI then you can log in from here to get additional features in PRECISE-TBI such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into PRECISE-TBI you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within PRECISE-TBI that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
