Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00051796
Proper Citation: RRID:WB-STRAIN:WBStrain00051796
Description: Caenorhabditis elegans with name unc-70(mir6[loxP] mir16[loxP]) V. from WB.
Species: Caenorhabditis elegans
Synonyms: unc-70(mir6[loxP] mir16[loxP]) V.
Notes: Made_by: Ravi Das|"Superficially wild-type. LoxP sites were inserted into near the 5' and 3' ends of the endogenous unc-70 locus to facilitate conditional or cell-specific knockout of the gene. The 5' loxP site can be detected by PCR using the primers 5' tttattaatctatgatttttcagcaaaa 3' and 5' tgacgataatctcttaaaattttgc 3'. The 3' loxP site can be detected by PCR using the primers 5' acgtactgtcgctgaggttacc 3' and 5' gacgtcgatacaaataattcgtccca 3'. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987"
Affected Gene: WBGene00006803(unc-70)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for unc-70(mir6[loxP] mir16[loxP]) V..
No alerts have been found for unc-70(mir6[loxP] mir16[loxP]) V..
Source: Integrated Animals
Source Database: WormBase (WB)
