Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00051696
Proper Citation: RRID:WB-STRAIN:WBStrain00051696
Description: Caenorhabditis elegans with name asp-3(utx47[mNG::3xFlag::asp-3]) X. from WB.
Species: Caenorhabditis elegans
Synonyms: asp-3(utx47[mNG::3xFlag::asp-3]) X.
Notes: Made_by: Stephen Pullman (Glow Worms '21)|"N-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58."
Affected Gene: WBGene00000216(asp-3)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for asp-3(utx47[mNG::3xFlag::asp-3]) X..
No alerts have been found for asp-3(utx47[mNG::3xFlag::asp-3]) X..
Source: Integrated Animals
Source Database: WormBase (WB)
