Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00037967
Proper Citation: RRID:WB-STRAIN:WBStrain00037967
Description: Caenorhabditis elegans with name syd-1(gk802) unc-4(e120) II. from WB.
Species: Caenorhabditis elegans
Synonyms: syd-1(gk802) unc-4(e120) II.
Notes: F35D2.5. Unc. External left primer: TCAACGTTGTCGCTGATCTC. External right primer: CCTCAAATTCACGGAATGCT. External WT amplicon: 543 bp. This strain carries a point mutation in F35D2.5. The mutation is gk802, which is an A->T mutation at F35D2 coordinate 23221 (flanking sequences TCGACCAACTCACTAACTCTTGAGGGCCAT and TCGACAAAATCATTTGGAGACTTGAAGATG).|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Affected Gene: WBGene00006363(syd-1)|WBGene00006744(unc-4)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for VC10078.
No alerts have been found for VC10078.
Source: Integrated Animals
Source Database: WormBase (WB)
