Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00037966
Proper Citation: RRID:WB-STRAIN:WBStrain00037966
Description: Caenorhabditis elegans with name unc-4(e120) Y46E12BL.2(gk801gk909) II. from WB.
Species: Caenorhabditis elegans
Synonyms: unc-4(e120) Y46E12BL.2(gk801gk909) II.
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y46E12BL.2. Unc. External left primer: ATCCACAATGCTCCGATCTC. External right primer: TCTGGCTTGCTTTTGTGATG. External WT amplicon: 540 bp. This strain contains two point mutations in Y46E12BL.2. The first is gk801, which is a G->A mutation at Y46E12BL coordinate 21938 (flanking sequences GTTCTTGAAGCTATACGGCTTTACACAGAA and TTACTCCAGCCGATCTGGTCACCCGTTATG). The second is gk909, which is an A->G mutation at Y46E12BL coordinate 21966 (flanking sequences AAGTTACTCCAGCCGATCTGGTCACCCGTT and TGTCGATAGTGCGATCGCCAAGTCCAAGGA)."
Affected Gene: WBGene00006744(unc-4)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for VC10077.
No alerts have been found for VC10077.
Source: Integrated Animals
Source Database: WormBase (WB)
