Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00034457
Proper Citation: RRID:WB-STRAIN:WBStrain00034457
Description: Caenorhabditis elegans with name klp-19(bn126)/mT1 [dpy-10(e128)] III. from WB.
Species: Caenorhabditis elegans
Synonyms: klp-19(bn126)/mT1 [dpy-10(e128)] III.
Notes: Heterozygotes are WT and segregate WT, Dpys (mT1 homozygotes) and L1 lethals (bn126 homozygotes). klp-19 deletion is 435 bases between TTCACAGTGTTCGTGGAGAA and GCAAGGAATCGCGCCGGCT. klp-19 deletion is lethal over hT2.|"Mutagen:UV/TMP"|"Supplementary_genotype klp-19(bn126)mT1[dpy-10(e128)] III."
Affected Gene: WBGene00001072(dpy-10)|WBGene00002229(klp-19)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for SS746.
No alerts have been found for SS746.
Source: Integrated Animals
Source Database: WormBase (WB)
