Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Organism Name
ZT3
RRID:WB-STRAIN:WBStrain00040879 RRID Copied  
PDF Report How to cite
RRID:WB-STRAIN:WBStrain00040879
Copy Citation Copied
Organism Information

URL: http://www.wormbase.org/db/get?name=WBStrain00040879

Proper Citation: RRID:WB-STRAIN:WBStrain00040879

Description: Caenorhabditis elegans with name csr-1(fj54) IV/nT1 [qIs51] (IV;V). from WB.

Species: Caenorhabditis elegans

Synonyms: csr-1(fj54) IV/nT1 [qIs51] (IV;V).

Notes: Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.|"Made_by: Moriguchi/Tabara"|"Mutagen:UV/TMP"

Affected Gene: WBGene00017641(csr-1)

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for ZT3.

No alerts have been found for ZT3.

Data and Source Information

Source: Integrated Animals

Source Database: WormBase (WB)