Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00040878
Proper Citation: RRID:WB-STRAIN:WBStrain00040878
Description: Caenorhabditis elegans with name drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). from WB.
Species: Caenorhabditis elegans
Synonyms: drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Notes: Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.|"Made_by: Moriguchi/Kuroki"|"Mutagen:UV/TMP"
Affected Gene: WBGene00000254(bli-4)|WBGene00008400(drh-3)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for ZT2.
No alerts have been found for ZT2.
Source: Integrated Animals
Source Database: WormBase (WB)
