Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405855877
Proper Citation: RRID:RGD_405855877
Description: Rattus norvegicus with name SD-Foxo4em1Soar+/+ from RGD.
Species: Rattus norvegicus
Notes: This is the wild type littermate from crossing of heterozygous mutant female rats with wild-type male rats to generate hemizygous null male rats and wild type mutant. Foxo4 mutant strain (RGD:405855876) was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for SD-Foxo4em1Soar+/+.
No alerts have been found for SD-Foxo4em1Soar+/+.
Source: Integrated Animals
Source Database: Rat Genome Database (RGD)
