Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401938598
Proper Citation: RRID:RGD_401938598
Description: Rattus norvegicus with name SS-Del(2q)1Mcwi -/- from RGD.
Species: Rattus norvegicus
Notes: Four single guide RNAs and SpCas9 targeting sequences ATGAAGTGCCTAGCTTCATT, GAAGCTAGGCACTTCATCTA, ATTCATAATGGGACACTCGA, and CCCAGCCTCAGATTCATAAT flanking a chromosome 2 region distal to Npr3 were targeted in SS/JrHsdMcwi embryos. A 29,508 bp deletion in chromosome 2 (rn6: chr2:61,845,176-61,874,684) resulted, along with an insertion of 3 nucleotides (TGG). Please contact: [email protected]
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for SS-Del(2q)1Mcwi -/-.
No alerts have been found for SS-Del(2q)1Mcwi -/-.
Source: Integrated Animals
Source Database: Rat Genome Database (RGD)
