Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/229549
Proper Citation: RRID:Addgene_229549
Insert Name: MG1655 attP21::PR-sfGFP::frt metB:frt
Organism: n/a
Bacterial Resistance: None
Defining Citation: PMID:40509754
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Comments: Primers for sequence verification of metB knock-out: Fwd - prEP213, acgatcggtctggcttagtt Rev - prEP214, tgaccgtaaacccgcatagt Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for TB204 △metB.
No alerts have been found for TB204 △metB.
Source: Addgene
