Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Plasmid Name
RRID:Addgene_164956 RRID Copied  
PDF Report How to cite
RRID:Addgene_164956
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/164956

Proper Citation: RRID:Addgene_164956

Insert Name: kcnn1a

Organism: Danio rerio

Bacterial Resistance: Kanamycin

Defining Citation: PMID:33728688

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin

Comments: The DNA sequence was amplified from pooled wild-type TAB zebrafish embryos. According to the predicted sequence, XP_005171293.1, there are likely polymorphisms, K185E, H323Y, S599N, which are not listed in the current ENSEMBL database. This is possibly due to incomplete zebrafish genome annotation, GRCz11. In addition, at the 5’ end of the insert, there are 44bps extra forward primer dimer sequences (ATGCGGCATCGGCACGCGGGCCATGCGGCATCGGCACGCGGGCC) before the start codon. But this will not impact the result of the whole mount in situ hybridization.

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pENTR-D-TOPO-kcnn1a.

No alerts have been found for pENTR-D-TOPO-kcnn1a.

Data and Source Information

Source: Addgene