X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Organism Name
RRID:WB-STRAIN:WBStrain00007911 RRID Copied  
PDF Report How to cite
RRID:WB-STRAIN:WBStrain00007911
Copy Citation Copied
Organism Information

URL: http://www.wormbase.org/db/get?name=WBStrain00007911

Proper Citation: RRID:WB-STRAIN:WBStrain00007911

Description: Caenorhabditis elegans with name eri-1(mg366) IV. from WB.

Species: Caenorhabditis elegans

Synonyms: eri-1(mg366) IV.

Notes: Temperature sensitive: sterile at 25C. Maintain at 15C. Him. Eri. Due to a direct repeat the exact site and sequence of the 23 bp eri-1(mg366) insertion is unclear, however, the insertion lies in exon 6 of T07A9 between nucleotide positions 35215 and 35204 of cosmid T07A9 and includes 23 or these 32 nucleotides tttatcgaaaaaaaaacaggcactttatcgaa. Primers to follow eri-1mg366: GATAAAACTTCGGAACATATGGGGC and ACTGATGGGTAAGGAATCGAAGACG. These primers will give a 170 bp product in N2 and a 193 bp product in eri-1(mg366).

Affected Gene: WBGene00001332(eri-1)|WBGene00007091(eri-12)

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for GR1373.

No alerts have been found for GR1373.

Data and Source Information

Source: Integrated Animals

Source Database: WormBase (WB)