URL: http://www.wormbase.org/db/get?name=WBStrain00005260
Proper Citation: RRID:WB-STRAIN:WBStrain00005260
Description: Caenorhabditis elegans with name kyIs150 IV; sax-1(ky491) X. from WB.
Species: Caenorhabditis elegans
Synonyms: kyIs150 IV; sax-1(ky491) X.
Notes: kyIs150 [tax-2(delta)::GFP + lin-15(+)]. sax-1 is temperature-sensitive. ky491 was isolated by PCR from a deletion library. [NOTE: (12/29/2020) This strain has been found to actually be carrying the ky491 deletion allele of sax-1, not the ky211 point mutation as previously reported.] ky491 is a 1263 bp deletion in sax-1 (left flanking sequence: atgaagcccaggctgtgaataaattgaatg, right flanking sequence: ccaatcacagtcagcctccgataaaatgtc). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Affected Gene: WBGene00004727(sax-1)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for CX4103.
No alerts have been found for CX4103.
Source: WormBase (RRID:SCR_003098)
Description: Central data repository for nematode biology including complete genomic sequence, gene predictions and orthology assignments from range of related nematodes.Data concerning genetics, genomics and biology of C. elegans and related nematodes. Derived from initial ACeDB database of C. elegans genetic and sequence information, WormBase includes genomic, anatomical and functional information of C. elegans, other Caenorhabditis species and other nematodes. Maintains public FTP site where researchers can find many commonly requested files and datasets, WormBase software and prepackaged databases.
URL: http://www.wormbase.org
Source Database: WormBase (WB)