You are being redirected to the external resource authority website. If you haven't been redirected in 10 seconds, please click http://www.wormbase.org/db/get?name=WBStrain00034642.

For additional information about this resource, such as mentions, alerts, rating and validation information, please view our Resource Report (shown below).

View Resource Report


Organism Name
SX922
RRID:WB-STRAIN:WBStrain00034642 RRID Copied  
PDF Report How to cite 
RRID:WB-STRAIN:WBStrain00034642
Copy Citation Copied
Organism Information

URL: http://www.wormbase.org/db/get?name=WBStrain00034642

Proper Citation: RRID:WB-STRAIN:WBStrain00034642

Description: Caenorhabditis elegans with name prg-1(n4357) I. from WB.

Species: Caenorhabditis elegans

Synonyms: prg-1(n4357) I.

Notes: 21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT|"no longer available from the CGC."

Affected Gene: WBGene00004178(prg-1)

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts
Report Information

No rating or validation information has been found for SX922.

No alerts have been found for SX922.

Data and Source Information

Source: WormBase (RRID:SCR_003098)
Description: Central data repository for nematode biology including complete genomic sequence, gene predictions and orthology assignments from range of related nematodes.Data concerning genetics, genomics and biology of C. elegans and related nematodes. Derived from initial ACeDB database of C. elegans genetic and sequence information, WormBase includes genomic, anatomical and functional information of C. elegans, other Caenorhabditis species and other nematodes. Maintains public FTP site where researchers can find many commonly requested files and datasets, WormBase software and prepackaged databases.
URL: http://www.wormbase.org

Source Database: WormBase (WB)