URL: http://www.addgene.org/66939
Proper Citation: RRID:Addgene_66939
Insert Name: gRNA frame +0
Bacterial Resistance: Ampicillin
Defining Citation: PMID:27465542
Vector Backbone Description: Backbone Marker:Hornung Lab; Vector Backbone:pCAS9-mCherry; Vector Types:; Bacterial Resistance:Ampicillin
Comments: please check ip situation sequence with: tacgatacaaggctgttagagag
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pCAS9-mCherry-Frame +0.
No alerts have been found for pCAS9-mCherry-Frame +0.
Source: Addgene
