URL: http://www.addgene.org/43803
Proper Citation: RRID:Addgene_43803
Insert Name: CAN1.y gRNA
Organism: Saccharomyces cerevisiae
Bacterial Resistance: Ampicillin
Defining Citation: PMID:23460208
Vector Backbone Description: Backbone Size:5886; Vector Backbone:p426; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: For more information on Church Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/church/ gRNA target sequence GATACGTTCTCTATGGAGGA
Expand AllWe found {{ ctrl2.mentions.total_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for p426-SNR52p-gRNA.CAN1.Y-SUP4t.
No alerts have been found for p426-SNR52p-gRNA.CAN1.Y-SUP4t.
Source: Addgene