X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Plasmid Name
RRID:Addgene_43803 RRID Copied  
PDF Report How to cite
RRID:Addgene_43803
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/43803

Proper Citation: RRID:Addgene_43803

Insert Name: CAN1.y gRNA

Organism: Saccharomyces cerevisiae

Bacterial Resistance: Ampicillin

Defining Citation: PMID:23460208

Vector Backbone Description: Backbone Size:5886; Vector Backbone:p426; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin

Comments: For more information on Church Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/church/ gRNA target sequence GATACGTTCTCTATGGAGGA

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.total_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for p426-SNR52p-gRNA.CAN1.Y-SUP4t.

No alerts have been found for p426-SNR52p-gRNA.CAN1.Y-SUP4t.

Data and Source Information

Source: Addgene