X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Plasmid Name
RRID:Addgene_29663 RRID Copied  
PDF Report How to cite
RRID:Addgene_29663
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/29663

Proper Citation: RRID:Addgene_29663

Bacterial Resistance: Kanamycin

Defining Citation: PMID:

Vector Backbone Description: Backbone Size:6075; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV-cleavable His6 fusion tag on its N-terminus. GFP can enhance your protein's expression and solubility. It can also be used as a reporter gene. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/macrolab/

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.total_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pET His6 GFP TEV LIC cloning vector (1GFP).

No alerts have been found for pET His6 GFP TEV LIC cloning vector (1GFP).

Data and Source Information

Source: Addgene