X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Plasmid Name
RRID:Addgene_91834 RRID Copied  
PDF Report How to cite
RRID:Addgene_91834
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/91834

Proper Citation: RRID:Addgene_91834

Bacterial Resistance: Ampicillin

Defining Citation: PMID:32550377

Vector Backbone Description: Backbone Marker:Erik Jorgensen lab (Addgene #73715); Vector Backbone:pMLS256; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin

Comments: pMLS256 was modified by replacing the sgRNA scaffod with the "F+E" sgRNA and the sgRNA promoter with the one from pDD162.The sgRNA can be sequenced with primer ggtgtgaaataccgcacaga (same primer as used for pDD162).

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pDD379.

No alerts have been found for pDD379.

Data and Source Information

Source: Addgene