X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Plasmid Name
RRID:Addgene_86613 RRID Copied  
PDF Report How to cite
RRID:Addgene_86613
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/86613

Proper Citation: RRID:Addgene_86613

Insert Name: ATP1A1 G3 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)

Organism: S. pyogenes

Bacterial Resistance: Ampicillin

Defining Citation: PMID:28417998

Vector Backbone Description: Vector Backbone:pX330-U6-Chimeric_BB-CBh-hSpCas9; Vector Types:Mammalian Expression, CRISPR, Co-selection via HDR using ouabain; Bacterial Resistance:Ampicillin

Comments: ATP1A1 G3 gRNA target sequence is GAGTTCTGTAATTCAGCATA

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA.

No alerts have been found for eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA.

Data and Source Information

Source: Addgene