Resource Report

URL: http://www.addgene.org/69602

Proper Citation: RRID:Addgene_69602

Insert Name: Runx1 +23 intronic enhancer

Organism: Mus musculus

Bacterial Resistance: Kanamycin

Defining Citation: PMID:25594182

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4777; Vector Backbone:pENTR attL4-R1; Vector Types:5' Gateway Entry Vector; Bacterial Resistance:Kanamycin

Comments: All PCR was performed using the High Fidelity Advantage 2 PCR Kit (Clontech). The Runx1 +23 enhancer (1) was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (XhoI and BamHI sites added) 5’-GGCTCGAGGGATCCGGGGTGGGAGGTGTAAGTTC-3’ and Reverse (BglII and NotI sites added) 5’- GGGCGGCCGCAGATCTCAGGTGTCAGCAACCCATC -3’. The PCR fragment was gel purified, XhoI/BglII digested, ligated into XhoI/BamHI digested Tol2kit (2) #228 p5E-MCS vector and sequence verified. The mouse beta-globin minimal promoter was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (SpeI site added) 5’-GGACTAGTCCAATCTGCTCAGAGAGGACA-3’ and Reverse (SacII site added) 5’-GGCCGCGGGATGTCTGTTTCTGAGGTTGC-3’. The beta-globin minimal promoter and Runx1+23 5’ entry vector were SpeI/SacII digested and ligated together. Multisite Gateway reactions were performed according to the Invitrogen protocol. 1. Nottingham, W. T., Jarratt, A., Burgess, M., Speck, C. L., Cheng, J.-F., Prabhakar, S., et al. (2007). Runx1-mediated hematopoietic stem-cell emergence is controlled by a Gata/Ets/SCL-regulated enhancer. Blood, 110(13), 4188–4197. http://doi.org/10.1182/blood-2007-07-100883 2. Kwan, K. M., Fujimoto, E., Grabher, C., Mangum, B. D., Hardy, M. E., Campbell, D. S., et al. (2007). The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Developmental Dynamics : an Official Publication of the American Association of Anatomists, 236(11), 3088–3099. http://doi.org/10.1002/dvdy.21343

Expand All Collapse