URL: http://www.addgene.org/29769
Proper Citation: RRID:Addgene_29769
Insert Name: None
Bacterial Resistance: Ampicillin
Vector Backbone Description: Backbone Size:5472; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This plasmid can be used as a single-expression vector, and it is also compatible with our 2-series polycistronic destination vectors (2D, 2E, and 2Z), if co-expression with other genes is desired. mCherry has a excitation max of 587 nm and an emission max of 610 nm. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5' TTTAAGAAGGAGATATAGATC3' Reverse - 5' GTTGGAGGATGAGAGGATCCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with EcoRV, then gel purify. When digesting the DNA with T4 polymerase, use dGTP for the insert and dCTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pET mCherry LIC cloning vector (u-mCherry).
No alerts have been found for pET mCherry LIC cloning vector (u-mCherry).
Source: Addgene
