URL: http://www.addgene.org/26870
Proper Citation: RRID:Addgene_26870
Insert Name: CBFRE
Bacterial Resistance: Ampicillin
Defining Citation: PMID:17721509
Vector Backbone Description: Backbone Marker:Gaiano Lab; Backbone Size:0; Vector Backbone:CBFRE-EGFP; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Comments: CBFRE: four (mutated) CBF1-binding elements from EBV (see Hsieh MCB 1996, 16:952) and the basal simian virus 40 (SV40) promoter upstream of EGFP. The sequence of the mutated CBF1 binding element is (GATCTGGTGTAAA CACGGGCTTGGAAAAAATTTATG).
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for CBFRE (mt) EGFP.
No alerts have been found for CBFRE (mt) EGFP.
Source: Addgene