X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Plasmid Name
RRID:Addgene_18738 RRID Copied  
PDF Report How to cite
RRID:Addgene_18738
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/18738

Proper Citation: RRID:Addgene_18738

Insert Name: DscamL

Organism: Mus musculus

Bacterial Resistance: Kanamycin

Defining Citation: PMID:18216854

Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV script; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Comments: A fragment of mouse Dscam-like-1 cDNA was amplified from the mKIAA1132 plasmid (Kazusa DNA Research Institute) using the following primers: GGCCGCGGCCGCCCGCACGGCCGGCCACAGGACCACC and CGCGGTCGACAGGTCCCAGTGTGGAGCCCTTCTCC. This fragment was cloned into the NotI/SalI sites of pCMVscript. To complete its open reading frame, a BglII fragment of this plasmid was replaced by a cDNA amplified from mouse brain using the following primers: GGCCAGATCTCCGCACGGCCGGCCACAGGACCACC and CGCGAGATCTGTTGCCGTTGTGCTTGAGGGAGAC.

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pCMV mouse Dscam-like.

No alerts have been found for pCMV mouse Dscam-like.

Data and Source Information

Source: Addgene