SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Plasmid Name
RRID:Addgene_13031 RRID Copied  
PDF Report How to cite
RRID:Addgene_13031
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/13031

Proper Citation: RRID:Addgene_13031

Insert Name: Enhanced Green Fluorescent Protein

Bacterial Resistance: Ampicillin

Vector Backbone Description: Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Comments: The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pcDNA3-EGFP.

No alerts have been found for pcDNA3-EGFP.

Data and Source Information

Source: Addgene