URL: http://www.addgene.org/118844
Proper Citation: RRID:Addgene_118844
Bacterial Resistance: Ampicillin
Defining Citation: PMID:30385465
Vector Backbone Description: Vector Backbone:MiniCoopR; Vector Types:CRISPR, Tol2; Bacterial Resistance:Ampicillin
Comments: Use the BseRI enzyme to clone gRNA of interest in the first U6:gRNA cassette. Use primer: CCATACCACATTTGTAGAGGT to sequence insert. Use the aaRI enzyme to clone gRNA of interest in the second U6:gRNA cassette. Use primer: GCTTACAACAAACACAGAGA to sequence insert.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for MiniCoopR 2xU6:gRNA, mitfa:Cas9.
No alerts have been found for MiniCoopR 2xU6:gRNA, mitfa:Cas9.
Source: Addgene
