URL: http://www.addgene.org/11665
Proper Citation: RRID:Addgene_11665
Insert Name: FF3
Organism: Firefly
Bacterial Resistance: Chloramphenicol
Defining Citation: PMID:16141338
Vector Backbone Description: Backbone Size:8595; Vector Backbone:pPRIME-CMV-Neo; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol
Comments: CMV promoter transcribes Neo and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site. Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pPRIME-CMV-Neo-FF3.
No alerts have been found for pPRIME-CMV-Neo-FF3.
Source: Addgene