Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
flp-32(gk3692[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047541 | Caenorhabditis elegans | flp-32(gk3692[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 284 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATGCGATTGCTGCTTCATTTGTTATTCG; Right flanking sequence: TGGAAGCCATGCCAAGGTGAGTGGAAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010982(flp-32) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010982(flp-32) | WB-STRAIN:WBStrain00047541 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:17 | 0 | ||||
|
W04C9.5(gk3705[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047543 | Caenorhabditis elegans | W04C9.5(gk3705[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 855 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCCACATGGTGACCTAGGTTTACAGGTGGT; Right flanking sequence: AGGTATGCAACAACGCTCCATTGCTAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047543 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:17 | 0 | ||||
|
EEED8.12(gk3721[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047544 | Caenorhabditis elegans | EEED8.12(gk3721[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 264 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAATTGTAGAGTTAAAATCTACATTTCCA; Right flanking sequence: CAGAAGGGAAACCATAAATAACGATGAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047544 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:17 | 0 | ||||
|
kin-24(gk3724[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047546 | Caenorhabditis elegans | kin-24(gk3724[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 978 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAACATCACCGACTCGCGTGCAAAATCCG; Right flanking sequence: GGTTCCAGCAATGCAGGCTGTTCTCAGTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00002206(kin-24)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00002206(kin-24), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047546 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:17 | 0 | ||||
|
Y45F10D.15(gk5175) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047560 | Caenorhabditis elegans | Y45F10D.15(gk5175) IV. | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5175 mutation is C->T, flanking sequences TCAATCCGCAAAAAGATGCAGAGAAGGTAA and TGAAAAATTGTGTAGGTAAGAAAAAAAAAA.|"Made_by: Vancouver KO Group" | WBGene00012893(Y45F10D.15) | WBGene00012893(Y45F10D.15) | WB-STRAIN:WBStrain00047560 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:17 | 0 | ||||
|
Y37H9A.1(gk5174) .I Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047559 | Caenorhabditis elegans | Y37H9A.1(gk5174) .I | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5174 mutation is G->A, flanking sequences AAATCCCTAGAAAAAAATCGATTTTTTTCA and CTTCCACCGAAAATTCAACGTGTAGAATCC.|"Made_by: Vancouver KO Group" | WBGene00012576(Y37H9A.1) | WBGene00012576(Y37H9A.1) | WB-STRAIN:WBStrain00047559 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:17 | 0 | ||||
|
ilys-4(gk3827[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 IV; +/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047551 | Caenorhabditis elegans | ilys-4(gk3827[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 IV; +/nT1 V. | Homozygous lethal or sterile deletion balanced by nT1. Deletion of 692 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous nT1 is non-GFP vulvaless hermaphrodite that bags. Left flanking sequence: CTTAATTTTTTAGTGGAAGACGATCATCCA; Right flanking sequence: GGGAACAATTGGATATTGGAAAAGAGTTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00016958(ilys-4) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00016958(ilys-4) | WB-STRAIN:WBStrain00047551 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:17 | 0 | ||||
|
C48B6.3(gk5054[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047552 | Caenorhabditis elegans | C48B6.3(gk5054[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 801 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CGAGCTGTTCTTCGAGAACTGGCGGTGCCC; Right flanking sequence: AAATAACTCAACGACATCTCCAACGTCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047552 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:17 | 0 | ||||
|
igeg-1(gk5079[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047553 | Caenorhabditis elegans | igeg-1(gk5079[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 1917 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAATTGGAGAGAGCAGTGGACAGAGGT; Right flanking sequence: TGAGGGGAATACGCCAGGTTTCGCCAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047553 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:17 | 0 | ||||
|
lron-1(gk5081[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047554 | Caenorhabditis elegans | lron-1(gk5081[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 3289 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGATCACTCATTTCCTTATTCTTTCCAGGT; Right flanking sequence: TTTGGTTTCCTATCCCTTTTCAACAAATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00008093(lron-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00008093(lron-1) | WB-STRAIN:WBStrain00047554 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:17 | 0 | ||||
|
tni-4(gk5170) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047556 | Caenorhabditis elegans | tni-4(gk5170) IV. | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5170 mutation is G->A, flanking sequences TCATTCCACTTCCAGATTTGGATAACGAAG and TAAGTGTTCTGAAGATGAAAACAACTATTT.|"Made_by: Vancouver KO Group" | WBGene00006586(tni-4) | WBGene00006586(tni-4) | WB-STRAIN:WBStrain00047556 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:17 | 0 | ||||
|
T27E7.4(gk5171) IV; irk-2(gk5172) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047557 | Caenorhabditis elegans | T27E7.4(gk5171) IV; irk-2(gk5172) X. | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5171 mutation is G->A, flanking sequences CTCTGATAATAAAACATTTGTAAAGTGTTC and AATGATATTTTTCGTTGCAGATTGTTTTTT. The gk5172 mutation is T->C, flanking sequences GACGCTTTCCACCACTCCTTCCAAAATTGC and GAAAATTTGAAAACATTTGGATTTTCTATT.|"Made_by: Vancouver KO Group" | WBGene00002150(irk-2)|WBGene00012089(T27E7.4) | WBGene00002150(irk-2), WBGene00012089(T27E7.4) | WB-STRAIN:WBStrain00047557 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:17 | 0 | ||||
|
F11A5.3(gk3668[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047537 | Caenorhabditis elegans | F11A5.3(gk3668[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 370 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTGTGTGTATGTATGTAGATCAGTGTTCC; Right flanking sequence: CGGAAAGTCTAATCTATTGCTGCGATTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047537 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:16 | 0 | ||||
|
T26C12.3(gk3686[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047539 | Caenorhabditis elegans | T26C12.3(gk3686[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 569 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAAATCGACCAATTCCTCGAATGGGAATCT; Right flanking sequence: CGGATCCAAGAAGGATATGAGAGTCAAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047539 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:16 | 0 | ||||
|
D2005.4(gk5300) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047590 | Caenorhabditis elegans | D2005.4(gk5300) I. | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5300 mutation is G->A, flanking sequences AATCTTGATTTTAAATGCGAACGATTTTCA and GGCGAAGACTACAATGTGCAGCAGGCAAAA.|"Made_by: Vancouver KO Group" | WBGene00008399(D2005.4) | WBGene00008399(D2005.4) | WB-STRAIN:WBStrain00047590 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:17 | 0 | ||||
|
Y57G11B.2(gk5309[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047592 | Caenorhabditis elegans | Y57G11B.2(gk5309[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 2052 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTTAATCTGAAAAGCAACACTAGAAACCA; Right flanking sequence: GGGTTCAAATCAATTATTTCTGTAATTTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047592 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:17 | 0 | ||||
|
K02E11.4(gk5314[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047594 | Caenorhabditis elegans | K02E11.4(gk5314[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 1078 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAGTACGACAGAAAGCTGCTGATGTGC; Right flanking sequence: AAAGGGTTACTACACAATTGTTCAAACTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047594 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:17 | 0 | ||||
|
rig-5(gk5383[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047626 | Caenorhabditis elegans | rig-5(gk5383[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 8834 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTGGCTGAATCCACTTGAATTGCTCGGAGC; Right flanking sequence: GTAATAGCGACGATTGAGCAATGAAGAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004372(rig-5)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004372(rig-5), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047626 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:18 | 0 | ||||
|
C32D5.6(gk5390[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047627 | Caenorhabditis elegans | C32D5.6(gk5390[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 1833 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTACATCATCGGTGTTCGACATCCCATTG; Right flanking sequence: AAATTTGAAAAAAAAAACTACAATGACTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047627 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:18 | 0 | ||||
|
toh-1(gk5396[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00047629 | Caenorhabditis elegans | toh-1(gk5396[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 4219 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTAACGTGTCCTTAAAAAGACTCAAATGTT; Right flanking sequence: AGGTAGCCTGAAATTAGATTTAAAGTAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006591(toh-1)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006591(toh-1), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00047629 | WormBase (WB) | WB | unknown | 2026-09-05 04:56:18 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The data sets included in this resource are published in Kravitz et al, 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement (Nat. Neurosci).
