Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 91 showing 1801 ~ 1820 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00035183

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035183

Source Database: WormBase (WB)
Availability: available
Source References: PMID:31323240
Synonyms: baIs4.
Alternate IDs: WB-STRAIN:UA57, CGC_UA57
Notes: baIs4 [dat-1p::GFP + dat-1p::CAT-2]. GFP expression in CEP, ADE and PDE neurons. From integration of baEx33.|"Made_by: Caldwell Lab"|"WBStrain mapped, WBPaper00060404 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00035183 Copy   


  • RRID:WB-STRAIN:WBStrain00035186

http://www.wormbase.org/db/get?name=WBStrain00035186

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:UA134
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00035186 Copy   


  • RRID:WB-STRAIN:WBStrain00035185

http://www.wormbase.org/db/get?name=WBStrain00035185

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:UA133
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00035185 Copy   


  • RRID:WB-STRAIN:WBStrain00035144

http://www.wormbase.org/db/get?name=WBStrain00035144

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:26024448
Synonyms: unc-119(ed3) ruIs32 III; ojIs1.
Alternate IDs: WB-STRAIN:TY3558, CGC_TY3558
Notes: ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Histone and tubulin GFP.

Proper citation: RRID:WB-STRAIN:WBStrain00035144 Copy   


  • RRID:WB-STRAIN:WBStrain00035145

http://www.wormbase.org/db/get?name=WBStrain00035145

Source Database: WormBase (WB)
Affected Genes: WBGene00004750(sea-1)
Genomic Alteration: WBGene00004750(sea-1)
Availability: available
Source References: EMPTY
Synonyms: sea-1(y356) II.
Alternate IDs: WB-STRAIN:TY3579, CGC_TY3579
Notes: Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains.

Proper citation: RRID:WB-STRAIN:WBStrain00035145 Copy   


  • RRID:WB-STRAIN:WBStrain00035148

http://www.wormbase.org/db/get?name=WBStrain00035148

Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001087(dpy-28)|WBGene00001609(glp-1)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001087(dpy-28), WBGene00001609(glp-1)
Availability: available
Source References: EMPTY
Synonyms: dpy-28(y402)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III.
Alternate IDs: WB-STRAIN:TY3837, CGC_TY3837
Notes: qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP y402 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.

Proper citation: RRID:WB-STRAIN:WBStrain00035148 Copy   


  • RRID:WB-STRAIN:WBStrain00035155

http://www.wormbase.org/db/get?name=WBStrain00035155

Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001087(dpy-28)|WBGene00001609(glp-1)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001087(dpy-28), WBGene00001609(glp-1)
Availability: available
Source References: EMPTY
Synonyms: dpy-28(s939)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III.
Alternate IDs: WB-STRAIN:TY4381, CGC_TY4381
Notes: Made_by: A. Severson|"qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP s939 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal."

Proper citation: RRID:WB-STRAIN:WBStrain00035155 Copy   


  • RRID:WB-STRAIN:WBStrain00035156

http://www.wormbase.org/db/get?name=WBStrain00035156

Source Database: WormBase (WB)
Affected Genes: WBGene00006318(sup-9)
Genomic Alteration: WBGene00006318(sup-9)
Availability: available
Source References: EMPTY
Synonyms: sup-9(n1012) II.
Alternate IDs: WB-STRAIN:TY4851, CGC_TY4851
Notes: Made_by: Aaron Stevenson|"Superficially wild-type."

Proper citation: RRID:WB-STRAIN:WBStrain00035156 Copy   


  • RRID:WB-STRAIN:WBStrain00035160

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035160

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00002034(htp-3)
Genomic Alteration: WBGene00000254(bli-4), WBGene00002034(htp-3)
Availability: available
Source References: EMPTY
Synonyms: htp-3(tm3655) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I,III).
Alternate IDs: WB-STRAIN:TY5038, CGC_TY5038
Notes: Made_by: Aaron Stevenson|"Segregates WT GFP+ heterozygotes, GFP- tm3655 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Avoid picking viable aneuploids that often appear larger and longer than wild-type."

Proper citation: RRID:WB-STRAIN:WBStrain00035160 Copy   


  • RRID:WB-STRAIN:WBStrain00035162

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035162

Source Database: WormBase (WB)
Affected Genes: WBGene00000592(coh-3)|WBGene00004333(rec-8)|WBGene00021560(coh-4)
Genomic Alteration: WBGene00000592(coh-3), WBGene00004333(rec-8), WBGene00021560(coh-4)
Availability: available
Source References: EMPTY
Synonyms: rec-8(ok978)/nT1 IV; coh-4(tm1857) coh-3(gk112) V/nT1 [qIs51] V.
Alternate IDs: WB-STRAIN:TY5121, CGC_TY5121
Notes: Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile rec-8(ok978); coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.|"Made_by: Aaron Stevenson"

Proper citation: RRID:WB-STRAIN:WBStrain00035162 Copy   


  • RRID:WB-STRAIN:WBStrain00035161

http://www.wormbase.org/db/get?name=WBStrain00035161

Source Database: WormBase (WB)
Affected Genes: WBGene00000592(coh-3)|WBGene00021560(coh-4)
Genomic Alteration: WBGene00000592(coh-3), WBGene00021560(coh-4)
Availability: available
Source References: PMID:37078421, PMID:37650378
Synonyms: +/nT1 IV; coh-4(tm1857) coh-3(gk112) V/nT1 [qIs51] V.
Alternate IDs: WB-STRAIN:TY5120, CGC_TY5120
Notes: Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.|"Made_by: Aaron Stevenson"|"Supplementary_genotype coh-4(tm1857) coh-3(gk112) V/nT1 [qls51] (IV;V)"

Proper citation: RRID:WB-STRAIN:WBStrain00035161 Copy   


  • RRID:WB-STRAIN:WBStrain00035164

http://www.wormbase.org/db/get?name=WBStrain00035164

Source Database: WormBase (WB)
Affected Genes: WBGene00000592(coh-3)|WBGene00004985(spo-11)|WBGene00021560(coh-4)
Genomic Alteration: WBGene00000592(coh-3), WBGene00004985(spo-11), WBGene00021560(coh-4)
Availability: available
Source References: EMPTY
Synonyms: spo-11(me44)/nT1 IV; coh-4(tm1857) coh-3(gk112)/nT1[qIs51] V.
Alternate IDs: WB-STRAIN:TY5425, CGC_TY5425
Notes: Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF & Meyer BJ. 2014. eLife. 2014 Aug 29;3:e03467.

Proper citation: RRID:WB-STRAIN:WBStrain00035164 Copy   


  • RRID:WB-STRAIN:WBStrain00035129

http://www.wormbase.org/db/get?name=WBStrain00035129

Source Database: WormBase (WB)
Availability: available
Source References: PMID:7896094
Synonyms: meDf6 X; yDp13 (X;f).
Alternate IDs: WB-STRAIN:TY2137, CGC_TY2137
Notes: meDf6; yDp13 is WT hermaphrodite which is Him. 27% of self-progeny are WT males. yDp13 recombines with X, but such recombination is greatly reduced in an meDf6 background. Maintain by picking L4 hermaphrodites and checking to make sure they give lots of dead eggs and lots of males. [yDp13 XO males with an intact X chromosome are >90% inviable.]|"Mutagen:Gamma Rays"

Proper citation: RRID:WB-STRAIN:WBStrain00035129 Copy   


  • RRID:WB-STRAIN:WBStrain00035122

http://www.wormbase.org/db/get?name=WBStrain00035122

Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00006749(unc-9)
Genomic Alteration: WBGene00003056(lon-2), WBGene00006749(unc-9)
Availability: available
Source References: PMID:7896094
Synonyms: yDp9 (X;A); lon-2(e678) unc-9(e101) X.
Alternate IDs: WB-STRAIN:TY1914, CGC_TY1914
Notes: Lon non-Unc hermaphrodite strain. yDp9 is homozygous viable. yDp9/+ XO animals are fertile males.|"Mutagen:Gamma Rays"

Proper citation: RRID:WB-STRAIN:WBStrain00035122 Copy   


  • RRID:WB-STRAIN:WBStrain00035121

http://www.wormbase.org/db/get?name=WBStrain00035121

Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00006749(unc-9)
Genomic Alteration: WBGene00003056(lon-2), WBGene00006749(unc-9)
Availability: available
Source References: PMID:7896094
Synonyms: yDp8/+ (X;A); lon-2(e678) unc-9(e101) X.
Alternate IDs: WB-STRAIN:TY1913, CGC_TY1913
Notes: Animals heterozygous for yDp8 are Lon non-Unc hermaphrodites. Animals which have lost yDp8 are LonUnc. Animals homozygous for yDp8 are Dpy and sick hermaphrodites. yDp8/+ XO males are Dpy and infertile.|"Mutagen:Gamma Rays"

Proper citation: RRID:WB-STRAIN:WBStrain00035121 Copy   


  • RRID:WB-STRAIN:WBStrain00035123

http://www.wormbase.org/db/get?name=WBStrain00035123

Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00006749(unc-9)
Genomic Alteration: WBGene00003056(lon-2), WBGene00006749(unc-9)
Availability: available
Source References: PMID:7896094
Synonyms: yDp10/+ (X;A); lon-2(e678) unc-9(e101) X.
Alternate IDs: WB-STRAIN:TY1915, CGC_TY1915
Notes: Animals heterozygous for yDp10 are Lon non-Unc hermaphrodites. Animals which have lost yDp10 are LonUnc. Animals homozygous for yDp10 are Dpy and sick hermaphrodites. yDp10/+ XO animals are Dpy and infertile males.|"Mutagen:Gamma Rays"

Proper citation: RRID:WB-STRAIN:WBStrain00035123 Copy   


  • RRID:WB-STRAIN:WBStrain00035126

http://www.wormbase.org/db/get?name=WBStrain00035126

Source Database: WormBase (WB)
Affected Genes: WBGene00001088(dpy-30)
Genomic Alteration: WBGene00001088(dpy-30)
Availability: available
Source References: PMID:7982580
Synonyms: dpy-30(y228) V/nT1 [unc-?(n754) let-?] (IV;V).
Alternate IDs: WB-STRAIN:TY1936, CGC_TY1936
Notes: Heterozygotes are Unc and segregate Unc, dead eggs and temperature sensitive Dpys. At 15C the y228 homozygotes (derived from heterozygous mothers) are WT and most of their progeny are inviable, dying as arrested embryos or as necrotic Uncoordinated and Constipated L1 larvae; a small number of animals survive and develop into Dpy, Egl adults with a protruding vulva. At 25C the y228 homozygotes (derived from a heterozygous mother) are Dpy and Egl and have a protruding vulva; progeny from these animals are inviable and die as embryos or L1 larvae. See also WBPaper00002302.

Proper citation: RRID:WB-STRAIN:WBStrain00035126 Copy   


  • RRID:WB-STRAIN:WBStrain00035125

http://www.wormbase.org/db/get?name=WBStrain00035125

Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00006749(unc-9)
Genomic Alteration: WBGene00003056(lon-2), WBGene00006749(unc-9)
Availability: available
Source References: PMID:7896094
Synonyms: lon-2(e678) unc-9(e101) X; yDp12 (X;f).
Alternate IDs: WB-STRAIN:TY1917, CGC_TY1917
Notes: Free duplication. Animals with yDp12 are Lon non-Unc hermaphrodites. Animals which have lost yDp12 are LonUnc. yDp12/+ XO animals are fertile males.|"Mutagen:Gamma Rays"

Proper citation: RRID:WB-STRAIN:WBStrain00035125 Copy   


  • RRID:WB-STRAIN:WBStrain00035128

http://www.wormbase.org/db/get?name=WBStrain00035128

Source Database: WormBase (WB)
Affected Genes: WBGene00001065(dpy-3)|WBGene00001867(him-8)|WBGene00006742(unc-2)
Genomic Alteration: WBGene00001065(dpy-3), WBGene00001867(him-8), WBGene00006742(unc-2)
Availability: available
Source References: PMID:7896094
Synonyms: him-8(e1489) IV; dpy-3(e27) unc-2(e55) X; yDp16 (X;f).
Alternate IDs: WB-STRAIN:TY2071, CGC_TY2071
Notes: Mutagen:Gamma Rays|"non-Unc, somewhat Dpy hermaphrodites. Gives DpyUncs when yDp16 is lost."

Proper citation: RRID:WB-STRAIN:WBStrain00035128 Copy   


  • RRID:WB-STRAIN:WBStrain00035130

http://www.wormbase.org/db/get?name=WBStrain00035130

Source Database: WormBase (WB)
Availability: available
Source References: PMID:7896094
Synonyms: meDf6 X; yDp15 (X;f).
Alternate IDs: WB-STRAIN:TY2138, CGC_TY2138
Notes: meDf6; yDp15 is WT hermaphrodite which is Him. 23% of self-progeny are WT males. yDp15 recombines with X, but such recombination is greatly reduced in an meDf6 background. Maintain strain by picking L4 hermaphrodites and making sure they give lots of dead eggs and lots of males. [yDp15 XO males with an intact X chromosome are >90% inviable.]|"Mutagen:Gamma Rays"

Proper citation: RRID:WB-STRAIN:WBStrain00035130 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within Kravitz that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X