Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 74 showing 1461 ~ 1480 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00035508

http://www.wormbase.org/db/get?name=WBStrain00035508

Source Database: WormBase (WB)
Affected Genes: WBGene00006836(unc-112)
Genomic Alteration: WBGene00006836(unc-112)
Availability: available
Source References: EMPTY
Synonyms: unc-112(r367) V; gkDf2 X.
Alternate IDs: WB-STRAIN:VC100, CGC_VC100
Notes: gkDf2. Multiple genes deleted. Deletion extents determined by oligo array CGH. Deletion size: ~44kb. Deletion left flank: TTAGTAAGCCGGAAAATGGATTTCGCTTTTCTCCTATTGAGAAACCTAAA. Deletion right flank: CTACCTTTCAAAATGAATAGCAACCACTTTTTCGACGAAGAAATGTTCGT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035508 Copy   


  • RRID:WB-STRAIN:WBStrain00035509

http://www.wormbase.org/db/get?name=WBStrain00035509

Source Database: WormBase (WB)
Affected Genes: WBGene00006650(tts-1)
Genomic Alteration: WBGene00006650(tts-1)
Availability: available
Source References: EMPTY
Synonyms: tts-1(gk105) X.
Alternate IDs: WB-STRAIN:VC107, CGC_VC107
Notes: F09E10.10. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035509 Copy   


  • RRID:WB-STRAIN:WBStrain00035584

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035584

Source Database: WormBase (WB)
Affected Genes: WBGene00000391(cdd-1)
Genomic Alteration: WBGene00000391(cdd-1)
Availability: available
Source References: PMID:32049015
Synonyms: cdd-1(ok390) X.
Alternate IDs: WB-STRAIN:VC208, CGC_VC208
Notes: C47D2.2. Superficially wild type.|"Mutagen:UV/TMP"|"Reference WBPaper00059294 added based on published strain data identified by Textpresso literature search."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035584 Copy   


  • RRID:WB-STRAIN:WBStrain00035587

http://www.wormbase.org/db/get?name=WBStrain00035587

Source Database: WormBase (WB)
Affected Genes: WBGene00010510(ent-3)
Genomic Alteration: WBGene00010510(ent-3)
Availability: available
Source References: EMPTY
Synonyms: ent-3(gk158) V.
Alternate IDs: WB-STRAIN:VC211, CGC_VC211
Notes: K02E11.1. Superficially wild type.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035587 Copy   


  • RRID:WB-STRAIN:WBStrain00035590

http://www.wormbase.org/db/get?name=WBStrain00035590

Source Database: WormBase (WB)
Affected Genes: WBGene00006409(hdl-2)
Genomic Alteration: WBGene00006409(hdl-2)
Availability: available
Source References: EMPTY
Synonyms: hdl-2(ok440) IV.
Alternate IDs: WB-STRAIN:VC217, CGC_VC217
Notes: C09G9.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035590 Copy   


  • RRID:WB-STRAIN:WBStrain00035593

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035593

Source Database: WormBase (WB)
Affected Genes: WBGene00000553(cmk-1)|WBGene00044213(Y102A5C.36)
Genomic Alteration: WBGene00000553(cmk-1), WBGene00044213(Y102A5C.36)
Availability: available
Source References: EMPTY
Synonyms: cmk-1(ok287) IV; gkDf56 Y102A5C.36(gk3558) V.
Alternate IDs: WB-STRAIN:VC220, CGC_VC220
Notes: Mutagen:UV/TMP|"This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCT AGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH."|"This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035593 Copy   


  • RRID:WB-STRAIN:WBStrain00035519

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035519

Source Database: WormBase (WB)
Affected Genes: WBGene00006876(vab-10)
Genomic Alteration: WBGene00006876(vab-10)
Availability: available
Source References: PMID:38177158, PMID:38302462
Synonyms: vab-10(gk45) I.
Alternate IDs: WB-STRAIN:VC117, CGC_VC117
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK1151.1a. Superficially wild type."

Proper citation: RRID:WB-STRAIN:WBStrain00035519 Copy   


  • RRID:WB-STRAIN:WBStrain00035596

http://www.wormbase.org/db/get?name=WBStrain00035596

Source Database: WormBase (WB)
Affected Genes: WBGene00006411(octr-1)
Genomic Alteration: WBGene00006411(octr-1)
Availability: available
Source References: EMPTY
Synonyms: octr-1(ok371) X.
Alternate IDs: WB-STRAIN:VC224, CGC_VC224
Notes: F14D12.6. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035596 Copy   


  • RRID:WB-STRAIN:WBStrain00035511

http://www.wormbase.org/db/get?name=WBStrain00035511

Source Database: WormBase (WB)
Affected Genes: WBGene00000145(apc-11)
Genomic Alteration: WBGene00000145(apc-11)
Availability: available
Source References: EMPTY
Synonyms: apc-11(gk37)/eT1 III; +/eT1 V.
Alternate IDs: WB-STRAIN:VC109, CGC_VC109
Notes: F35G12.9. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and sterile homozygous gk37 hermaphrodites. Pick WT hermaphrodites and check for correct segregation of progeny to maintain.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035511 Copy   


  • RRID:WB-STRAIN:WBStrain00035510

http://www.wormbase.org/db/get?name=WBStrain00035510

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: H32C10(gk36) IV.
Alternate IDs: WB-STRAIN:VC108, CGC_VC108
Notes: H32C10. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035510 Copy   


  • RRID:WB-STRAIN:WBStrain00035598

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035598

Source Database: WormBase (WB)
Affected Genes: WBGene00002048(ida-1)
Genomic Alteration: WBGene00002048(ida-1)
Availability: available
Source References: EMPTY
Synonyms: ida-1(ok409) III.
Alternate IDs: WB-STRAIN:VC226, CGC_VC226
Notes: B0244.2. Slow-growing, and some animals appear sterile or Egl. Tail defects are common, and hermaphrodites can be mistaken for males in extreme cases.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035598 Copy   


  • RRID:WB-STRAIN:WBStrain00035512

http://www.wormbase.org/db/get?name=WBStrain00035512

Source Database: WormBase (WB)
Affected Genes: WBGene00004248(pus-1)
Genomic Alteration: WBGene00004248(pus-1)
Availability: available
Source References: EMPTY
Synonyms: pus-1(gk38) V.
Alternate IDs: WB-STRAIN:VC110, CGC_VC110
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W06H3.2. Superficially wild type."

Proper citation: RRID:WB-STRAIN:WBStrain00035512 Copy   


  • RRID:WB-STRAIN:WBStrain00035602

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035602

Source Database: WormBase (WB)
Affected Genes: WBGene00001687(gpn-1)
Genomic Alteration: WBGene00001687(gpn-1)
Availability: available
Source References: PMID:38177158
Synonyms: gpn-1(ok377) X.
Alternate IDs: WB-STRAIN:VC233, CGC_VC233
Notes: F59D12.4. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035602 Copy   


  • RRID:WB-STRAIN:WBStrain00035605

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035605

Source Database: WormBase (WB)
Affected Genes: WBGene00001309(emr-1)
Genomic Alteration: WBGene00001309(emr-1)
Availability: available
Source References: EMPTY
Synonyms: emr-1(gk119) I.
Alternate IDs: WB-STRAIN:VC237, CGC_VC237
Notes: M01D7.6. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035605 Copy   


  • RRID:WB-STRAIN:WBStrain00035604

http://www.wormbase.org/db/get?name=WBStrain00035604

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003915(pan-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003915(pan-1)
Availability: available
Source References: EMPTY
Synonyms: +/mT1 II; pan-1(gk142)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC235, CGC_VC235
Notes: M88.6a. Heterozygotes are WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous gk142 hermaphrodites (dpyish L1 or L2 larvae). Pick WT hermaphrodites and check for correct segregation of progeny to maintain.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035604 Copy   


  • RRID:WB-STRAIN:WBStrain00035606

http://www.wormbase.org/db/get?name=WBStrain00035606

Source Database: WormBase (WB)
Affected Genes: WBGene00006308(sul-1)
Genomic Alteration: WBGene00006308(sul-1)
Availability: available
Source References: EMPTY
Synonyms: sul-1(gk151) X.
Alternate IDs: WB-STRAIN:VC238, CGC_VC238
Notes: K09C4.8. Superficially wild type.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035606 Copy   


  • RRID:WB-STRAIN:WBStrain00035609

http://www.wormbase.org/db/get?name=WBStrain00035609

Source Database: WormBase (WB)
Affected Genes: WBGene00001435(fkh-3)
Genomic Alteration: WBGene00001435(fkh-3)
Availability: available
Source References: EMPTY
Synonyms: fkh-3(ok455) X.
Alternate IDs: WB-STRAIN:VC241, CGC_VC241
Notes: C29F7.4. Superficially wild type.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035609 Copy   


  • RRID:WB-STRAIN:WBStrain00035682

http://www.wormbase.org/db/get?name=WBStrain00035682

Source Database: WormBase (WB)
Affected Genes: WBGene00003275(mir-47)
Genomic Alteration: WBGene00003275(mir-47)
Availability: available
Source References: PMID:38594249
Synonyms: mir-47(gk167) X.
Alternate IDs: WB-STRAIN:VC328, CGC_VC328
Notes: K02B9.5. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035682 Copy   


  • RRID:WB-STRAIN:WBStrain00035685

http://www.wormbase.org/db/get?name=WBStrain00035685

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: F53B6(gk201) I.
Alternate IDs: WB-STRAIN:VC332, CGC_VC332
Notes: F53B6. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035685 Copy   


  • RRID:WB-STRAIN:WBStrain00035687

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00035687

Source Database: WormBase (WB)
Affected Genes: WBGene00002043(hyl-1)
Genomic Alteration: WBGene00002043(hyl-1)
Availability: available
Source References: EMPTY
Synonyms: hyl-1(gk203) IV.
Alternate IDs: WB-STRAIN:VC334, CGC_VC334
Notes: C09G4.1. Superficially wild type.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00035687 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within Kravitz that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X