Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 73 showing 1441 ~ 1460 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00034483

http://www.wormbase.org/db/get?name=WBStrain00034483

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00006788(unc-53)|WBGene00006893(spon-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00006788(unc-53), WBGene00006893(spon-1)
Availability: available
Source References: EMPTY
Synonyms: spon-1(nc30) ncIs2/dpy-10(e128) unc-53(n569) II.
Alternate IDs: WB-STRAIN:ST30, CGC_ST30
Notes: Made_by: Go Shioi|"ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, DpyUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced. Neurons visualized with ncIs2."

Proper citation: RRID:WB-STRAIN:WBStrain00034483 Copy   


  • RRID:WB-STRAIN:WBStrain00034484

http://www.wormbase.org/db/get?name=WBStrain00034484

Source Database: WormBase (WB)
Affected Genes: WBGene00001076(dpy-17)|WBGene00003497(mup-4)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001076(dpy-17), WBGene00003497(mup-4), WBGene00006768(unc-32)
Availability: available
Source References: EMPTY
Synonyms: ncIs2 II; mup-4(nc35)/dpy-17(e164) unc-32(e189) III.
Alternate IDs: WB-STRAIN:ST35, CGC_ST35
Notes: Made_by: Go Shioi|"ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, DpyUncs, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest as embyros or in larval development. Not well balanced. Neurons visualized with ncIs2."

Proper citation: RRID:WB-STRAIN:WBStrain00034484 Copy   


  • RRID:WB-STRAIN:WBStrain00034485

http://www.wormbase.org/db/get?name=WBStrain00034485

Source Database: WormBase (WB)
Affected Genes: WBGene00004047(plx-1)
Genomic Alteration: WBGene00004047(plx-1)
Availability: available
Source References: EMPTY
Synonyms: plx-1(nc36) IV.
Alternate IDs: WB-STRAIN:ST36, CGC_ST36
Notes: Made_by: Takashi Fujii|"Various epidermal defects. In male tails, ray 1 is dislocated anteriorly."

Proper citation: RRID:WB-STRAIN:WBStrain00034485 Copy   


  • RRID:WB-STRAIN:WBStrain00034487

http://www.wormbase.org/db/get?name=WBStrain00034487

Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004047(plx-1)
Genomic Alteration: WBGene00001864(him-5), WBGene00004047(plx-1)
Availability: available
Source References: EMPTY
Synonyms: plx-1(nc37) IV; him-5(e1490) V.
Alternate IDs: WB-STRAIN:ST54, CGC_ST54
Notes: Made_by: Takashi Fujii|"Various epidermal defects. In male tails, ray 1 is dislocated anteriorly."

Proper citation: RRID:WB-STRAIN:WBStrain00034487 Copy   


  • RRID:WB-STRAIN:WBStrain00034489

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034489

Source Database: WormBase (WB)
Affected Genes: WBGene00000100(ajm-1)
Genomic Alteration: WBGene00000100(ajm-1)
Availability: available
Source References: PMID:39212544
Synonyms: ncIs13.
Alternate IDs: WB-STRAIN:ST65, CGC_ST65
Notes: ncIs13 [ajm-1::GFP].

Proper citation: RRID:WB-STRAIN:WBStrain00034489 Copy   


  • RRID:WB-STRAIN:WBStrain00034402

http://www.wormbase.org/db/get?name=WBStrain00034402

Source Database: WormBase (WB)
Affected Genes: WBGene00003172(mec-8)|WBGene00004895(smu-1)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00003172(mec-8), WBGene00004895(smu-1), WBGene00006787(unc-52)
Availability: available
Source References: EMPTY
Synonyms: mec-8(u218) smu-1(mn602) I; unc-52(e669su250ts) II.
Alternate IDs: WB-STRAIN:SP2123, CGC_SP2123
Notes: Made_by: R Herman|"Temperature sensitive mec-8 allele, mechanosensory abnormal at 25 C. Reference: Spike CA, et al. Mol Cell Biol. 2001 Aug;21(15):4985-95."

Proper citation: RRID:WB-STRAIN:WBStrain00034402 Copy   


  • RRID:WB-STRAIN:WBStrain00034490

http://www.wormbase.org/db/get?name=WBStrain00034490

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: ncIs17.
Alternate IDs: WB-STRAIN:ST66, CGC_ST66
Notes: Mutagen:Gamma rays|"ncIs17 contains [hsp-16.2::eGFP + pBluscript]. Superficially wild-type."

Proper citation: RRID:WB-STRAIN:WBStrain00034490 Copy   


  • RRID:WB-STRAIN:WBStrain00034492

http://www.wormbase.org/db/get?name=WBStrain00034492

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:ST205
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00034492 Copy   


  • RRID:WB-STRAIN:WBStrain00034450

http://www.wormbase.org/db/get?name=WBStrain00034450

Source Database: WormBase (WB)
Affected Genes: WBGene00004027(pie-1)
Genomic Alteration: WBGene00004027(pie-1)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SS629
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00034450 Copy   


  • RRID:WB-STRAIN:WBStrain00034451

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034451

Source Database: WormBase (WB)
Affected Genes: WBGene00002059(ife-1)
Genomic Alteration: WBGene00002059(ife-1)
Availability: available
Source References: EMPTY
Synonyms: ife-1(bn127) III.
Alternate IDs: WB-STRAIN:SS712, CGC_SS712
Notes: Made_by: Dunkelbarger/Strome|"Mutagen:UV/TMP"|"Temperature sensitive sterility. Should be cultured at 15C or 20C. At 25C, spermatocytes fail in cytokinesis and accumulate as multinucleate cells unable to mature to spermatids. Milder defect in oogenesis is not temperature sensitive. Oocyte production is slowed, but appear relatively normal and are fertile. Inefficient translation of several maternal mRNAs (mex-1, oma-1, pos-1, and pal-1). Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 1, germ cell specific, P granule associated; F53A2.6). Homozygous 590 bp deletion starts at nt 191 in exon 1 and extends through exon 2 and into the 3' UTR to nt 780. The deletion removes over 70% of the coding region for IFE-1, including the helices and sheets that make up the mRNA platform and a Trp residue essential for m7GTP cap binding, suggesting it is a null mutation. Deletion breakpoint determined by sequencing by SS is: aagtggcctcaacgcgttgt"

Proper citation: RRID:WB-STRAIN:WBStrain00034451 Copy   


  • RRID:WB-STRAIN:WBStrain00034452

http://www.wormbase.org/db/get?name=WBStrain00034452

Source Database: WormBase (WB)
Affected Genes: WBGene00003993(pgl-2)
Genomic Alteration: WBGene00003993(pgl-2)
Availability: available
Source References: EMPTY
Synonyms: pgl-2(bn123) III.
Alternate IDs: WB-STRAIN:SS727, CGC_SS727
Notes: Fertile at all temperatures.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00034452 Copy   


  • RRID:WB-STRAIN:WBStrain00034454

http://www.wormbase.org/db/get?name=WBStrain00034454

Source Database: WormBase (WB)
Affected Genes: WBGene00003992(pgl-1)|WBGene00003993(pgl-2)|WBGene00006761(unc-24)
Genomic Alteration: WBGene00003992(pgl-1), WBGene00003993(pgl-2), WBGene00006761(unc-24)
Availability: available
Source References: EMPTY
Synonyms: pgl-2(bn123) III; pgl-1(bn101) unc-24(e138) IV.
Alternate IDs: WB-STRAIN:SS730, CGC_SS730
Notes: Mutagen:UV/TMP|"Unc. Maintain at 15C. Sterile at higher temperatures."

Proper citation: RRID:WB-STRAIN:WBStrain00034454 Copy   


  • RRID:WB-STRAIN:WBStrain00034455

http://www.wormbase.org/db/get?name=WBStrain00034455

Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00003993(pgl-2)|WBGene00003994(pgl-3)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00003993(pgl-2), WBGene00003994(pgl-3)
Availability: available
Source References: EMPTY
Synonyms: pgl-2(bn123) III; pgl-3(bn104) dpy-11(e224) V.
Alternate IDs: WB-STRAIN:SS731, CGC_SS731
Notes: Dpy. Fertile at all temperatures.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00034455 Copy   


  • RRID:WB-STRAIN:WBStrain00034456

http://www.wormbase.org/db/get?name=WBStrain00034456

Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00003992(pgl-1)|WBGene00003993(pgl-2)|WBGene00003994(pgl-3)|WBGene00006761(unc-24)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00003992(pgl-1), WBGene00003993(pgl-2), WBGene00003994(pgl-3), WBGene00006761(unc-24)
Availability: available
Source References: EMPTY
Synonyms: pgl-2(bn123) III; pgl-1(bn101) unc-24(e138) IV; pgl-3(bn104) dpy-11(e224) V.
Alternate IDs: WB-STRAIN:SS733, CGC_SS733
Notes: Dpy. Unc. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00034456 Copy   


  • RRID:WB-STRAIN:WBStrain00034457

http://www.wormbase.org/db/get?name=WBStrain00034457

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00002229(klp-19)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00002229(klp-19)
Availability: available
Source References: PMID:36617680
Synonyms: klp-19(bn126)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:SS746, CGC_SS746
Notes: Heterozygotes are WT and segregate WT, Dpys (mT1 homozygotes) and L1 lethals (bn126 homozygotes). klp-19 deletion is 435 bases between TTCACAGTGTTCGTGGAGAA and GCAAGGAATCGCGCCGGCT. klp-19 deletion is lethal over hT2.|"Mutagen:UV/TMP"|"Supplementary_genotype klp-19(bn126)mT1[dpy-10(e128)] III."

Proper citation: RRID:WB-STRAIN:WBStrain00034457 Copy   


  • RRID:WB-STRAIN:WBStrain00034469

http://www.wormbase.org/db/get?name=WBStrain00034469

Source Database: WormBase (WB)
Affected Genes: WBGene00001148(eat-20)
Genomic Alteration: WBGene00001148(eat-20)
Availability: available
Source References: PMID:10655217
Synonyms: eat-20(nc4)
Alternate IDs: WB-STRAIN:ST6, CGC_ST6
Notes: Starved appearance: shorter body length, pale intestine, reduced pharyngeal pumping, smaller brood size and extended egg-laing period.

Proper citation: RRID:WB-STRAIN:WBStrain00034469 Copy   


  • RRID:WB-STRAIN:WBStrain00034461

http://www.wormbase.org/db/get?name=WBStrain00034461

Source Database: WormBase (WB)
Affected Genes: WBGene00003405(mre-11)
Genomic Alteration: WBGene00003405(mre-11)
Availability: available
Source References: EMPTY
Synonyms: mre-11(iow1)/nT1[qIs51] (IV;V).
Alternate IDs: WB-STRAIN:SSM2, CGC_SSM2
Notes: Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP iow1 homozygotes (viable; see note below). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. iow1 is a separation-of-function allele of mre-11. Homozygotes develop into adults wild-type in appearance, but laying dead eggs due to defects in meiotic DSB repair: mre-11(iow1) worms form meiotic DSBs but are impaired in their resection. Pick GFP+ to maintain (mre-11(iow1)/nT1[qIs51]) and GFP- to obtain homozygous mre-11(iow1) worms for analysis. Reference: Yin Y & Smolikove S. Mol Cell Biol. 2013 Jul;33(14):2732-47. doi: 10.1128/MCB.00055-13. Epub 2013 May 13. Erratum in: Mol Cell Biol. 2015 Jul;35(14):2568. PubMed PMID: 23671188; PubMed Central PMCID: PMC3700128.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00034461 Copy   


  • RRID:WB-STRAIN:WBStrain00034463

http://www.wormbase.org/db/get?name=WBStrain00034463

Source Database: WormBase (WB)
Affected Genes: WBGene00009731(exo-1)
Genomic Alteration: WBGene00009731(exo-1)
Availability: available
Source References: PMID:36176234
Synonyms: exo-1(tm1842) III.
Alternate IDs: WB-STRAIN:SSM72, CGC_SSM72
Notes: Reference: Yin Y & Smolikove S. Mol Cell Biol. 2013 Jul;33(14):2732-47.|"Supplementary_genotype exo-1(tm1842)"

Proper citation: RRID:WB-STRAIN:WBStrain00034463 Copy   


  • RRID:WB-STRAIN:WBStrain00034464

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00034464

Source Database: WormBase (WB)
Affected Genes: WBGene00004297(rad-51)
Genomic Alteration: WBGene00004297(rad-51)
Availability: available
Source References: EMPTY
Synonyms: rad-51(iow53[GFP::rad-51]) IV/nT1[qIs51] (IV;V).
Alternate IDs: WB-STRAIN:SSM264, CGC_SSM264
Notes: Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes. Balancer is prone to breaking down. If a population contains a mix of bright and dim GFP animals, pick dim GFP and check for correct segregation of progeny to maintain. iow53 inserted a GFP tag at the N-terminus of the endogenous rad-51 locus, but the tagged protein is not fully functional. non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes form GFP foci in the germline that are mostly spo-11 dependent, and GFP::rad-51 homozygotes have defects in unloading RAD-51. Created by CRISPR using pDD282, therefore may also contain 3XFLAG. Reference: Koury E, et al. Nucleic Acids Res. 2018 Jan 25;46(2):748-764.|"Made_by: Matthew Wheat and Emily Koury"

Proper citation: RRID:WB-STRAIN:WBStrain00034464 Copy   


  • RRID:WB-STRAIN:WBStrain00034466

http://www.wormbase.org/db/get?name=WBStrain00034466

Source Database: WormBase (WB)
Affected Genes: WBGene00006706(ubc-9)
Genomic Alteration: WBGene00006706(ubc-9)
Availability: available
Source References: EMPTY
Synonyms: ubc-9(iow31[3xFLAG::ubc-9]) IV/nT1[qIs51] (IV;V)
Alternate IDs: WB-STRAIN:SSM291, CGC_SSM291
Notes: Heterozygotes are wild type with pharyngeal-expressed GFP, and segregate wild type GFP+ heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP ubc-9(iow31[3xFLAG::ubc-9]) homozygotes. ubc-9(iow31[3xFLAG::ubc-9]) homozygotes produce 100% dead embryos, but cytologically they have normal germline (examined by DAPI and RAD-51 staining), suggesting that 3xFLAG::ubc-9 is functional in the gonad but not in the non-maternally rescued embryo. Maintain the strain by picking GFP+ worms. 3XFLAG bas added by CRISPR/Cas9. Synonymous point mutation where included in the repair template (positions 30, 33 and 36 of coding sequence). Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441.|"Made_by: Rachel Reichman"|"No longer available from the CGC"

Proper citation: RRID:WB-STRAIN:WBStrain00034466 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within Kravitz that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X