Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 62 showing 1221 ~ 1240 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00055660

Source Database: WormBase (WB)
Affected Genes: WBGene00004479(rps-10)|WBGene00004489(rps-20)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00004479(rps-10), WBGene00004489(rps-20), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: rps-10(srf0825[K125R]) rps-20(srf1046[K6R+K9R]) unc-54(srf1004[unc-54::T2A::FLAG::rareArg12::GFP]) I.
Notes: Made_by: Parissa Monem|"Nuclear body wall muscle GFP+."

Proper citation: RRID:WB-STRAIN:WBStrain00055660 Copy   


  • RRID:WB-STRAIN:WBStrain00055704

http://www.wormbase.org/db/get?name=WBStrain00055704

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38598630
Synonyms: hpIs819; hpIs810.
Notes: hpIs819 [twk-40p(short)::GCaMP::T2A::NLS::mNeptune + lin-15(+)]. hpIs810 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Transgenic animals exhibit strong RFP signals in AVA soma and neurites; cytoplasmic GFP and RFP in AVA, AVE, AVB and some neurons in RVG and tail (DVA).

Proper citation: RRID:WB-STRAIN:WBStrain00055704 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055706

Source Database: WormBase (WB)
Affected Genes: WBGene00006691(twk-40)
Genomic Alteration: WBGene00006691(twk-40)
Availability: unknown
Source References: PMID:38598630
Synonyms: twk-40(hp834) III; hpIs814.
Notes: hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. twk-40(hp834) is a loss-of-function allele. twk-40(hp834) itself is highly loopy and a weak backward coiler. The presence of hpIs814 in the background reduces body bending and speed compared to twk-40(hp834) alone.

Proper citation: RRID:WB-STRAIN:WBStrain00055706 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055666

Source Database: WormBase (WB)
Affected Genes: WBGene00004323(rde-1)|WBGene00015107(viro-2)
Genomic Alteration: WBGene00004323(rde-1), WBGene00015107(viro-2)
Availability: unknown
Source References: EMPTY
Synonyms: viro-2(vir10) III; rde-1(ne219) V; jyIs8.
Notes: jyIs8 [pals-5p::GFP + myo-2p::mCherry]. Orsay virus infection defect. Reference: Jiang H, et al. mBio. 2017 Sep 5;8(5):e00940-17. doi: 10.1128/mBio.00940-17. PMID: 28874467.

Proper citation: RRID:WB-STRAIN:WBStrain00055666 Copy   


  • RRID:WB-STRAIN:WBStrain00055702

http://www.wormbase.org/db/get?name=WBStrain00055702

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: ljIs131; hpEx4340.
Notes: ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4340 [nmr-1p::TeTx::wCherry + sra-11p::TeTx::wCherry + HygromycinR]. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Transgenic animals are severely Unc. RFP positive head neuron soma can be observed under V16 in older animals. Hygromycin can be used to select for hpEx4340 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.

Proper citation: RRID:WB-STRAIN:WBStrain00055702 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055701

Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: unknown
Source References: PMID:38598630
Synonyms: lin-15B&lin-15A(n765) X; hpIs774; hpEx4292.
Notes: hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4292 [pdf-1p::LoxP::eBFP::LoxP::gtACR2::Cherry + twk-40p(short)::Cre + lin-15(+)]. Pick non-Muv to maintain. Red and green fluorescence in multiple head neurons. Activation of gtACR2 reduces AVB signals but does not generate specific changes in AVA.

Proper citation: RRID:WB-STRAIN:WBStrain00055701 Copy   


  • RRID:WB-STRAIN:WBStrain00055709

http://www.wormbase.org/db/get?name=WBStrain00055709

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38598630
Synonyms: hpEx4362.
Notes: hpEx4362 [flp-18p::cha-1(sense) + twk-40p::cha-1(antisense) + ttx-3p::GFP]. Pick animals with GFP expression in AIY to maintain. Transgenic animals exhibit reduced forward speed and body bending; this phenotype is not fully penetrate.

Proper citation: RRID:WB-STRAIN:WBStrain00055709 Copy   


  • RRID:WB-STRAIN:WBStrain00055652

http://www.wormbase.org/db/get?name=WBStrain00055652

Source Database: WormBase (WB)
Affected Genes: WBGene00001834(hda-1)
Genomic Alteration: WBGene00001834(hda-1)
Availability: unknown
Source References: EMPTY
Synonyms: hda-1(cw2) II.
Notes: hda-1(cw2) mutants are viable as homozygotes, although many die as embryos or larvae. Severely uncoordinated with defective vulval development and reduced fertility. Reference: Zinovyeva AY, et al. Dev Biol. 2006 Jan 1;289(1):229-42. PMID: 16313898

Proper citation: RRID:WB-STRAIN:WBStrain00055652 Copy   


  • RRID:WB-STRAIN:WBStrain00055651

http://www.wormbase.org/db/get?name=WBStrain00055651

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: yfSi1 II.
Notes: Made_by: Katja R Kasimatis|"yfSi1 [nspf-1p::nspf-1::6xHis::tbb-2 3' UTR + loxP, II:8420157]. C-terminal 6xHis-tagged NSPF-1 allows visualization of NSPF seminal fluid protein localization in males and hermaphrodites. Transgene inserted into ttTi5650 MosSCI site (II:8420157) using CRISPR/Cas9. Reference: Kasimatis KR, et al. (2022) No evidence of sexual conflict for a novel sperm-derived seminal fluid protein in Caenorhabditis nematodes. bioRxiv doi: https:"

Proper citation: RRID:WB-STRAIN:WBStrain00055651 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055650

Source Database: WormBase (WB)
Affected Genes: WBGene00003031(lin-46)
Genomic Alteration: WBGene00003031(lin-46)
Availability: unknown
Source References: EMPTY
Synonyms: lin-46(ma398[lin-46::mCherry]) V.
Notes: mCherry reporter inserted into C-terminus of endogenous lin-46 locus. Superficially wild-type. Fluorescent signal is very dim and bleaches very quickly. Reference: Ilbay O, et al. C. elegans LIN-28 controls temporal cell-fate progression by regulating LIN-46 expression via the 5UTR of lin-46 mRNA. bioRxiv 697490; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00055650 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055659

Source Database: WormBase (WB)
Affected Genes: WBGene00004479(rps-10)
Genomic Alteration: WBGene00004479(rps-10)
Availability: unknown
Source References: EMPTY
Synonyms: rps-10(srf1025[rps-10::3xHA]) I.
Notes: 3xHA tag inserted at C-terminus of endogenous rps-10 locus. Some growth defects on its own, which can be exacerbated in conjunction with mutants of no-go mRNA decay factors. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369|"Made_by: Parissa Monem"

Proper citation: RRID:WB-STRAIN:WBStrain00055659 Copy   


  • RRID:WB-STRAIN:WBStrain00055656

http://www.wormbase.org/db/get?name=WBStrain00055656

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: cwEx486.
Notes: cwEx486 [mnp-1p::mnp-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. Generated in N2 background.

Proper citation: RRID:WB-STRAIN:WBStrain00055656 Copy   


  • RRID:WB-STRAIN:WBStrain00055655

http://www.wormbase.org/db/get?name=WBStrain00055655

Source Database: WormBase (WB)
Affected Genes: WBGene00007139(mnp-1)
Genomic Alteration: WBGene00007139(mnp-1)
Availability: unknown
Source References: EMPTY
Synonyms: mnp-1(gm85) III.
Notes: Unc. Sma. Reference: Craft TR & Forrester WC. Dev Biol.2017 Apr 1;424(1):18-27. PMID: 28238735

Proper citation: RRID:WB-STRAIN:WBStrain00055655 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055657

Source Database: WormBase (WB)
Affected Genes: WBGene00001598(glh-1)
Genomic Alteration: WBGene00001598(glh-1)
Availability: unknown
Source References: EMPTY
Synonyms: glh-1(how3[3xHA::TurboID::glh-1]) I.
Notes: 3xHA::TurboID tag inserted at the N-terminus of the endogenous GLH-1. TurboID::GLH-1 promiscuously labels proteins at 20C. Transgene generated in N2 background. Reference: Price I, et al. ELife. 2021 Nov 3;10:e72276. doi: 10.7554/eLife.72276.

Proper citation: RRID:WB-STRAIN:WBStrain00055657 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055641

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017578(drl-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017578(drl-1)
Availability: unknown
Source References: EMPTY
Synonyms: drl-1(hd7062[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV.
Notes: Heterozygous strain, might not be homozygous viable. Deletion of 1309 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTTTGAATTGAAAAGGGAGTGGTTTCCCT; Right flanking sequence: CGGCATTGAGTCTGGCGGCTGTTGCCGGTG. sgRNA #1: CCGATTCCGTTCCTAATCAC; sgRNA #2: GATTGGAATGGTGTTATGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00055641 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055640

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: F10E9.4(hd7061[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ III.
Notes: Heterozygous strain, might not be homozygous viable. Deletion of 1418 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAACGAGGATGGAACTACAGAAGTCCAGGA; Right flanking sequence: AGGATATTGATCTCAATAGCTCCAATTAAA. sgRNA #1: AACAGAAAGTGAAGCACCAA; sgRNA #2: ATTATGACTATGTACTTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00055640 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055642

Source Database: WormBase (WB)
Affected Genes: WBGene00002198(kin-14)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00002198(kin-14), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: kin-14(hd7063[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 2852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATGGAAGTTTCGCCCAGCATTGTTTCAAA; Right flanking sequence: TGGCAGTTACAGTTAAGTTACAATATTTGG. sgRNA #1: GCGATTTCAGAAATGGTTGG; sgRNA #2: CAACGAAATTTGGCGCTGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00055642 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055648

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009663(hda-5)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009663(hda-5)
Availability: unknown
Source References: EMPTY
Synonyms: hda-5(hd7070[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 2776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATATACCTATTTTCTCCTTGTTTTCCCC; Right flanking sequence: TGGAAAGATCCTCGCTATATTAGAAGGTGG. sgRNA #1: TGATGTTTGACCGATTATGG; sgRNA #2: CTCCTCAGCCAAATTTGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00055648 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055645

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004083(pph-1)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004083(pph-1), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: pph-1(hd7066[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 2500 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTATTTTTTCGTTTTCAAAAAATAGTACCG; Right flanking sequence: CTGTCCCGGGTCCTTTCTTTTCTCCCGATT. sgRNA #1: CCTAGGTATTTTTGTTTTCT; sgRNA #2: CCCTTCAAACCATCACTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00055645 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055647

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: Y51B9A.9(hd7068[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 1571 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCCCAAATTCGGTCAGTGTACTGAAAATC; Right flanking sequence: CAATAATGCTGAGGAAAAAAGCTTCGAATA. sgRNA #1: TCATCCTTCATTTGTCTGGG; sgRNA #2: GAATTTTCAGGCAACACTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00055647 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within Kravitz that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X