Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 52 showing 1021 ~ 1040 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00055270

http://www.wormbase.org/db/get?name=WBStrain00055270

Source Database: WormBase (WB)
Affected Genes: WBGene00017483(lgc-22)
Genomic Alteration: WBGene00017483(lgc-22)
Availability: unknown
Source References: EMPTY
Synonyms: lgc-22(sy1478) IV.
Notes: Made_by: Heenam Park & Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-22. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGCTTCTCATTGCCACGTCACTGGCCGCCACGTTA right flanking sequence: GCGTGGGCGGCGGGCACCGCCGGCGGCTGCGAGGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACTGGCCGCCACGTTAGCG Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"

Proper citation: RRID:WB-STRAIN:WBStrain00055270 Copy   


  • RRID:WB-STRAIN:WBStrain00055256

http://www.wormbase.org/db/get?name=WBStrain00055256

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs654.
Notes: Made_by: Jun Young Oh/Stephanie Nava|"syIs654 [15xUAS:VSFP-Butterfly-1-2::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Voltage-sensitive fluorescent protein cGAL effector."

Proper citation: RRID:WB-STRAIN:WBStrain00055256 Copy   


  • RRID:WB-STRAIN:WBStrain00055255

http://www.wormbase.org/db/get?name=WBStrain00055255

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs640.
Notes: Made_by: Chun-Hao Chen/Stephanie Nava|"syIs640 [15xUAS::fem-3::mCherry::let-858 3'UTR + ttx-3p:RFP + 1kb DNA ladder (NEB)] cGAL effector to induce masculinization"

Proper citation: RRID:WB-STRAIN:WBStrain00055255 Copy   


  • RRID:WB-STRAIN:WBStrain00055257

http://www.wormbase.org/db/get?name=WBStrain00055257

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs657.
Notes: Made_by: Jun Young Oh/Stephanie Nava|"syIs657 [15xUAS::act-2::Venus::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. cGAL effector for localiziation of actin filament and cell cortex"

Proper citation: RRID:WB-STRAIN:WBStrain00055257 Copy   


  • RRID:WB-STRAIN:WBStrain00055261

http://www.wormbase.org/db/get?name=WBStrain00055261

Source Database: WormBase (WB)
Affected Genes: WBGene00010172(oac-36)
Genomic Alteration: WBGene00010172(oac-36)
Availability: unknown
Source References: EMPTY
Synonyms: oac-36(sy1411) I.
Notes: Made_by: Heenam Park & Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-36. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTAATGTGCATGTTGCTCAAGCGTGCCGAGACCAAGC right flanking sequence: CATTTTTCACAGTGGTATGCACATTTTACACGAGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACCACTGTGAAAAATGGCT Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"

Proper citation: RRID:WB-STRAIN:WBStrain00055261 Copy   


  • RRID:WB-STRAIN:WBStrain00055247

http://www.wormbase.org/db/get?name=WBStrain00055247

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs615.
Notes: Made_by: Jun Young Oh/Shahla Gharib|"syIs615 [15xUAS::lmp-1::Venus::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Lysosomal associated membrane protein cGAL effector."

Proper citation: RRID:WB-STRAIN:WBStrain00055247 Copy   


  • RRID:WB-STRAIN:WBStrain00055241

http://www.wormbase.org/db/get?name=WBStrain00055241

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs589.
Notes: Made_by: Jun Young Oh/Shahla Gharib|"syIs589 [15xUAS::wrmScarlet::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] mScarlet cGAL effector."

Proper citation: RRID:WB-STRAIN:WBStrain00055241 Copy   


  • RRID:WB-STRAIN:WBStrain00055240

http://www.wormbase.org/db/get?name=WBStrain00055240

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: syIs534; syIs300
Notes: Made_by: Chun-Hao Chen/Jun Young Oh|"syIs534 [flp-20p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + inx-11p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for gland cell. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation."

Proper citation: RRID:WB-STRAIN:WBStrain00055240 Copy   


  • RRID:WB-STRAIN:WBStrain00055242

http://www.wormbase.org/db/get?name=WBStrain00055242

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs591; syIs300.
Notes: Made_by: Jun Young Oh/Cynthia Chen|"syIs591 [srh-142p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ADF neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation."

Proper citation: RRID:WB-STRAIN:WBStrain00055242 Copy   


  • RRID:WB-STRAIN:WBStrain00055249

http://www.wormbase.org/db/get?name=WBStrain00055249

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: syIs627; syIs300.
Notes: Made_by: Jun Young Oh/Shahla Gharib|"syIs627 [str-2p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation."

Proper citation: RRID:WB-STRAIN:WBStrain00055249 Copy   


  • RRID:WB-STRAIN:WBStrain00055248

http://www.wormbase.org/db/get?name=WBStrain00055248

Source Database: WormBase (WB)
Affected Genes: WBGene00018728(frpr-8)
Genomic Alteration: WBGene00018728(frpr-8)
Availability: unknown
Source References: EMPTY
Synonyms: frpr-8(sy1362) X.
Notes: Made_by: Heenam Park & Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-8. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTTATTTCGCTTCTTAATAATTCTACACTGGTCA right flanking sequence: CTACGGATCAGCCAGGTTTTTCTGGAAGTACAAAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TAATTCTACACTGGTCACTA Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"

Proper citation: RRID:WB-STRAIN:WBStrain00055248 Copy   


  • RRID:WB-STRAIN:WBStrain00055238

http://www.wormbase.org/db/get?name=WBStrain00055238

Source Database: WormBase (WB)
Affected Genes: WBGene00019496(frpr-14)
Genomic Alteration: WBGene00019496(frpr-14)
Availability: unknown
Source References: EMPTY
Synonyms: frpr-14(sy1300) II.
Notes: Made_by: Heenam Park & Mandy Tan|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-14. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCGATATTTTGCAATTCCTGTTTGGGATCCACAG right flanking sequence: ATCCAGAATATTTGgtgagtttaggcttaggcttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACCAAATATTCTGGATCTG Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"

Proper citation: RRID:WB-STRAIN:WBStrain00055238 Copy   


  • RRID:WB-STRAIN:WBStrain00055237

http://www.wormbase.org/db/get?name=WBStrain00055237

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38096407
Synonyms: syIs587.
Notes: Made_by: Jun Young Oh/Shahla Gharib|"syIs587 [15xUAS::GCaMP7f::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. In vivo calcium indicator cGAL effector."

Proper citation: RRID:WB-STRAIN:WBStrain00055237 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055239

Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00011083(glo-1)
Genomic Alteration: WBGene00000898(daf-2), WBGene00011083(glo-1)
Availability: unknown
Source References: EMPTY
Synonyms: daf-2 (e1370) III; glo-1(sy1306) X.
Notes: Made_by: Heenam Park|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of glo-1 in daf-2 (e1370) background. left flanking sequence: GATAAAATTTCCTACAAAGTGTTGGTAATTGGTGA; right flanking sequence: TCCAGGTGTCGGTAAAACATCTATTATTCGTCG. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGTTGGTAATTGGTGATCC Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616"

Proper citation: RRID:WB-STRAIN:WBStrain00055239 Copy   


  • RRID:WB-STRAIN:WBStrain00055339

http://www.wormbase.org/db/get?name=WBStrain00055339

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: syIs815; syIs337.
Notes: Made_by: Mark Zhang/Stephanie Nava|"syIs815 [nlp-76p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector."

Proper citation: RRID:WB-STRAIN:WBStrain00055339 Copy   


  • RRID:WB-STRAIN:WBStrain00055399

http://www.wormbase.org/db/get?name=WBStrain00055399

Source Database: WormBase (WB)
Affected Genes: WBGene00018011(F33E11.3)
Genomic Alteration: WBGene00018011(F33E11.3)
Availability: unknown
Source References: EMPTY
Synonyms: F33E11.3(sy2024) V.
Notes: Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F33E11.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAATGTTCGATATCAGCGATTGGCTCAGGAGTATA. Right flanking sequence: CGAAGgtgcggacgagaaaattttttttttttttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTGGCTCAGGAGTATACGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616."

Proper citation: RRID:WB-STRAIN:WBStrain00055399 Copy   


  • RRID:WB-STRAIN:WBStrain00055398

http://www.wormbase.org/db/get?name=WBStrain00055398

Source Database: WormBase (WB)
Affected Genes: WBGene00009064(F22G12.4)
Genomic Alteration: WBGene00009064(F22G12.4)
Availability: unknown
Source References: EMPTY
Synonyms: F22G12.4(sy2022) I.
Notes: Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F22G12.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: caccaaaacccaaccaatttccagAGAACCTTTCGG. Right flanking sequence: CAATGGATTTCCTGCTCGGCAACGGAGCCGATGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCCAGAGAACCTTTCGGCAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616."

Proper citation: RRID:WB-STRAIN:WBStrain00055398 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055431

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: +/nT1[umnIs49] IV; Y61A9LA.10(ve782[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V.
Notes: Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 8730 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve782 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ctTCAGGAGCTGCTCGCCGATGAGCCAAGA ; Right flanking sequence: cacggcgtgcgcgtcagtgtcacgaaacgc. sgRNA #1: GCAAAACTTCGAAAGGCTCT; sgRNA #2: aaattggttgctgacgcgca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00055431 Copy   


  • RRID:WB-STRAIN:WBStrain00055397

http://www.wormbase.org/db/get?name=WBStrain00055397

Source Database: WormBase (WB)
Affected Genes: WBGene00009027(htt-1)
Genomic Alteration: WBGene00009027(htt-1)
Availability: unknown
Source References: EMPTY
Synonyms: F21G4.6(sy2013) X.
Notes: Made_by: Heenam Park|"Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F21G4.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAATAACGGATGAATTAAGTACAAATGTATCGTTG. Right flanking sequence: GACAGGGAATTAAACCTTTTGAAATCGGCACAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTACAAATGTATCGTTGGAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616."

Proper citation: RRID:WB-STRAIN:WBStrain00055397 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055430

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00003964(pdi-3)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00003964(pdi-3), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: pdi-3(ve781[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 4472 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagtcgaagctgcaaacaataaataaataa ; Right flanking sequence: gggaacaccgacaaaaagttaaaaactaag. sgRNA #1: attacaaaagggaaacaacg; sgRNA #2: ttagagggcgagagattatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00055430 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Kravitz Dataset1 Resources

    Welcome to the Kravitz Resources search. From here you can search through a compilation of resources used by Kravitz and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that Kravitz has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on Kravitz then you can log in from here to get additional features in Kravitz such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into Kravitz you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within Kravitz that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X